Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 43CTQ
Describe clonal selection and expansion.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 21 Solutions
Anatomy & Physiology
Ch. 21 - Visit this website...Ch. 21 - Visit this website...Ch. 21 - Visit this website...Ch. 21 - Immunity can be acquired in an active or passive...Ch. 21 - Which of the following cells is phagocytic? plasma...Ch. 21 - Which structure allows lymph from the lower right...Ch. 21 - Which of the following cells is important hi the...Ch. 21 - Which of the following cells would be most active...Ch. 21 - Which of the lymphoid nodules is most likely to...Ch. 21 - Which of the following signs is not characteristic...
Ch. 21 - Which of the following is not important in the...Ch. 21 - Enhanced phagocytosis of a cell by the binding of...Ch. 21 - Which of the following leads to the redness of...Ch. 21 - T cells that secrete cytokines that help antibody...Ch. 21 - The taking in of antigen and digesting it for...Ch. 21 - Why is clonal expansion so important? to select...Ch. 21 - The elimination of self-reactive thymocytes is...Ch. 21 - Which type of T cell is most effective against...Ch. 21 - Removing functionality from a B cell without...Ch. 21 - Which class of antibody crosses the placenta in...Ch. 21 - Which class of antibody has no known function...Ch. 21 - When does class switching occur? primary response...Ch. 21 - Which class of antibody is found in mucus? IgM IgA...Ch. 21 - Which enzymes in macrophages are important for...Ch. 21 - What type of chronic lung disease is caused by a...Ch. 21 - Which type of immune response is most directly...Ch. 21 - What is the reason that you have to be immunized...Ch. 21 - Which type of immune response works in conceit...Ch. 21 - Which type of hypersensitivity involves soluble...Ch. 21 - What causes the delay in delayed hypersensitivity?...Ch. 21 - Which of the following is a critical feature of...Ch. 21 - Which of the following is an autoimmune disease of...Ch. 21 - What drug is used to counteract the effects of...Ch. 21 - Which of the following terms means many genes?...Ch. 21 - Why do we have natural antibodies? We dont know...Ch. 21 - Which type of cancer is associated with HIV...Ch. 21 - How does cyclosporine A work? suppresses...Ch. 21 - What disease is associated with bone marrow...Ch. 21 - Describe the flow of lymph from its origins in...Ch. 21 - Describe the process of inflammation in an area...Ch. 21 - Describe two early induced responses and what...Ch. 21 - Describe the processing and presentation of an...Ch. 21 - Describe clonal selection and expansion.Ch. 21 - Describe how secondary B cell responses are...Ch. 21 - Describe the role of IgM in immunity.Ch. 21 - Describe how seroconversion works in HIV disease.Ch. 21 - Describe tuberculosis and the innocent bystander...Ch. 21 - Describe anaphylactic shock in someone sensitive...Ch. 21 - Describe rheumatic fever and how Tolerance is...Ch. 21 - Describe how stress affects immune responses.
Additional Science Textbook Solutions
Find more solutions based on key concepts
Match each of the following items with all the terms it applies to:
Human Physiology: An Integrated Approach (8th Edition)
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
What is the probability that each of thc following pairs of parents will produce the indicated offspring? (Assu...
Campbell Biology (11th Edition)
Some organizations are starting to envision a sustainable societyone in which each generation inherits sufficie...
Campbell Essential Biology (7th Edition)
1. Which parts of the skeleton belong to the appendicular skeleton? Which belong to the axial skeleton?
Human Anatomy & Physiology (2nd Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Before Darwin: Crash Course History of Science #19; Author: CrashCourse;https://www.youtube.com/watch?v=K4CKmYSMT_0;License: Standard Youtube License