Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20.5, Problem 17CYU
Summary Introduction
To review:
Functions of abundant endoplasmic reticulum in plasma cells. Other organelle(s)especially abundant in plasma cells and its reason.
Introduction:
Plasma cells are the cells produced by the B-lymphocytes. It is a differentiated B-lymphocyte, which matures when an antigen or a foreign particle is encountered. In a cell, certain organelles are in abundance depending on the type of function of the cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 20 Solutions
Anatomy & Physiology (6th Edition)
Ch. 20.1 - What distinguishes the innate defense system from...Ch. 20.1 - What is the first line of defense against disease?Ch. 20.2 - What is opsonization and how does it help...Ch. 20.2 - Under what circumstances might NK cells kill our...Ch. 20.2 - What are the cardinal signs of inflammation and...Ch. 20.3 - Name three key characteristics of adaptive...Ch. 20.3 - What is the difference between a complete antigen...Ch. 20.3 - What marks a cell as self as opposed to nonselfCh. 20.4 - What event (or observation) signals that a B or T...Ch. 20.4 - Which of the following T cells would survive...
Ch. 20.4 - Prob. 11CYUCh. 20.4 - In clonal selection, who does the selecting? What...Ch. 20.5 - Why is the secondary response to an antigen so...Ch. 20.5 - Prob. 14CYUCh. 20.5 - Which class of antibody is most abundant in blood?...Ch. 20.5 - List four ways in which antibodies can bring about...Ch. 20.5 - Prob. 17CYUCh. 20.6 - Class II MHC proteins display what kind of...Ch. 20.6 - Which type of T cell is the most important in both...Ch. 20.6 - Describe the killing mechanism of cytotoxic T...Ch. 20.7 - Prob. 21CYUCh. 20.7 - Prob. 22CYUCh. 20 - All of the following are considered innate body...Ch. 20 - The process by which neutrophils squeeze through...Ch. 20 - Antibodies released by plasma cells are involved...Ch. 20 - Which of the following antibodies can fix...Ch. 20 - Which antibody class is abundant in body...Ch. 20 - Small molecules that must combine with large...Ch. 20 - Lymphocytes that develop immunocompetence in the...Ch. 20 - Cells that can directly attack target cells...Ch. 20 - Prob. 9MCCh. 20 - The cell type most often invaded by HIV is a(n)...Ch. 20 - Complement fixation promotes all of the following...Ch. 20 - Using the letters from column B, match the cell...Ch. 20 - Besides acting as mechanical barriers, the skin...Ch. 20 - Explain why attempts at phagocytosis are not...Ch. 20 - What is complement? How does it cause bacterial...Ch. 20 - Interferons are referred to as antiviral proteins....Ch. 20 - Differentiate between humoral and cellular...Ch. 20 - Although the adaptive immune system has two arms,...Ch. 20 - Define immunocompetence and self-tolerance. How is...Ch. 20 - Differentiate between a primary and a secondary...Ch. 20 - Prob. 21SAQCh. 20 - What is the role of the variable regions of an...Ch. 20 - Name the five antibody classes and describe where...Ch. 20 - How do antibodies help defend the body?Ch. 20 - Do vaccines produce active or passive humoral...Ch. 20 - Prob. 26SAQCh. 20 - Describe the specific roles of helper, regulatory,...Ch. 20 - Prob. 28SAQCh. 20 - Prob. 29SAQCh. 20 - What events can result in autoimmune disease?Ch. 20 - Prob. 1CCSCh. 20 - Prob. 2CCSCh. 20 - Prob. 3CCSCh. 20 - Prob. 4CCSCh. 20 - Remember Mr. Ayers, the bus driver from Chapter...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license