
Anatomy & Physiology (6th Edition)
6th Edition
ISBN: 9780134156415
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 9MC
Summary Introduction
To determine:
Cells involved in the activation of a B cell includes all of the following except:
(a) Antigen
(b) Helper T cell
(c) Cytokine
(d) Cytotoxic T cell.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 20 Solutions
Anatomy & Physiology (6th Edition)
Ch. 20.1 - What distinguishes the innate defense system from...Ch. 20.1 - What is the first line of defense against disease?Ch. 20.2 - What is opsonization and how does it help...Ch. 20.2 - Under what circumstances might NK cells kill our...Ch. 20.2 - What are the cardinal signs of inflammation and...Ch. 20.3 - Name three key characteristics of adaptive...Ch. 20.3 - What is the difference between a complete antigen...Ch. 20.3 - What marks a cell as self as opposed to nonselfCh. 20.4 - What event (or observation) signals that a B or T...Ch. 20.4 - Which of the following T cells would survive...
Ch. 20.4 - Prob. 11CYUCh. 20.4 - In clonal selection, who does the selecting? What...Ch. 20.5 - Why is the secondary response to an antigen so...Ch. 20.5 - Prob. 14CYUCh. 20.5 - Which class of antibody is most abundant in blood?...Ch. 20.5 - List four ways in which antibodies can bring about...Ch. 20.5 - Prob. 17CYUCh. 20.6 - Class II MHC proteins display what kind of...Ch. 20.6 - Which type of T cell is the most important in both...Ch. 20.6 - Describe the killing mechanism of cytotoxic T...Ch. 20.7 - Prob. 21CYUCh. 20.7 - Prob. 22CYUCh. 20 - All of the following are considered innate body...Ch. 20 - The process by which neutrophils squeeze through...Ch. 20 - Antibodies released by plasma cells are involved...Ch. 20 - Which of the following antibodies can fix...Ch. 20 - Which antibody class is abundant in body...Ch. 20 - Small molecules that must combine with large...Ch. 20 - Lymphocytes that develop immunocompetence in the...Ch. 20 - Cells that can directly attack target cells...Ch. 20 - Prob. 9MCCh. 20 - The cell type most often invaded by HIV is a(n)...Ch. 20 - Complement fixation promotes all of the following...Ch. 20 - Using the letters from column B, match the cell...Ch. 20 - Besides acting as mechanical barriers, the skin...Ch. 20 - Explain why attempts at phagocytosis are not...Ch. 20 - What is complement? How does it cause bacterial...Ch. 20 - Interferons are referred to as antiviral proteins....Ch. 20 - Differentiate between humoral and cellular...Ch. 20 - Although the adaptive immune system has two arms,...Ch. 20 - Define immunocompetence and self-tolerance. How is...Ch. 20 - Differentiate between a primary and a secondary...Ch. 20 - Prob. 21SAQCh. 20 - What is the role of the variable regions of an...Ch. 20 - Name the five antibody classes and describe where...Ch. 20 - How do antibodies help defend the body?Ch. 20 - Do vaccines produce active or passive humoral...Ch. 20 - Prob. 26SAQCh. 20 - Describe the specific roles of helper, regulatory,...Ch. 20 - Prob. 28SAQCh. 20 - Prob. 29SAQCh. 20 - What events can result in autoimmune disease?Ch. 20 - Prob. 1CCSCh. 20 - Prob. 2CCSCh. 20 - Prob. 3CCSCh. 20 - Prob. 4CCSCh. 20 - Remember Mr. Ayers, the bus driver from Chapter...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning