ANATOMY & PHYSIOLOGY: AN INTEGRATIVE APP
3rd Edition
ISBN: 9781266163654
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 20.3, Problem 14LO
Summary Introduction
To compare and contrast: The hydrostatic pressure and colloid osmotic pressure in the capillaries.
Concept introduction: The cardiovascular system is composed of two components: heart and the blood vessels. Capillaries help in the exchange of blood and interstitial fluids. Capillary is very small and is a narrow tubule; their walls are made up of only endothelium. Endothelium in capillaries consists of a single layer of epithelial cells with a basement membrane. This helps in the easy movemen
t of fluid through them.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 20 Solutions
ANATOMY & PHYSIOLOGY: AN INTEGRATIVE APP
Ch. 20.1 - Prob. 1LOCh. 20.1 - Prob. 2LOCh. 20.1 - What are three differences in anatomic structure...Ch. 20.1 - Prob. 3LOCh. 20.1 - Prob. 2WDLCh. 20.1 - Prob. 4LOCh. 20.1 - Prob. 5LOCh. 20.1 - Prob. 6LOCh. 20.1 - What type of capillary is the most permeable, and...Ch. 20.1 - Prob. 7LO
Ch. 20.1 - Prob. 8LOCh. 20.1 - How does a vein serve as a blood reservoir?Ch. 20.1 - Prob. 9LOCh. 20.1 - Prob. 5WDLCh. 20.2 - Prob. 10LOCh. 20.2 - Prob. 11LOCh. 20.2 - In which type of vessel is blood flow the slowest?...Ch. 20.3 - Prob. 12LOCh. 20.3 - What substances are transported by diffusion...Ch. 20.3 - Prob. 13LOCh. 20.3 - Prob. 14LOCh. 20.3 - Prob. 8WDLCh. 20.3 - Prob. 15LOCh. 20.3 - Prob. 16LOCh. 20.3 - Prob. 1WDTCh. 20.3 - How does the hydrostatic pressure change from the...Ch. 20.3 - Which two pressures have the largest values?...Ch. 20.3 - Prob. 17LOCh. 20.3 - If these lymph vessels were nonfunctional, what...Ch. 20.4 - Prob. 18LOCh. 20.4 - Prob. 19LOCh. 20.4 - In what ways is angiogenesis stimulated in...Ch. 20.4 - Prob. 20LOCh. 20.4 - Prob. 13WDLCh. 20.4 - Prob. 21LOCh. 20.4 - Prob. 22LOCh. 20.4 - Prob. 23LOCh. 20.4 - What relationship exists between metabolic...Ch. 20.4 - Prob. 24LOCh. 20.4 - Prob. 15WDLCh. 20.5 - Prob. 25LOCh. 20.5 - Prob. 26LOCh. 20.5 - Prob. 27LOCh. 20.5 - Prob. 28LOCh. 20.5 - Prob. 16WDLCh. 20.5 - Prob. 17WDLCh. 20.5 - How is the small pressure gradient in veins...Ch. 20.5 - How is the pressure gradient to move blood through...Ch. 20.5 - Prob. 29LOCh. 20.5 - How is resistance defined?Ch. 20.5 - What are the three factors that alter resistance?...Ch. 20.5 - Prob. 30LOCh. 20.5 - Prob. 31LOCh. 20.5 - Prob. 22WDLCh. 20.6 - Prob. 32LOCh. 20.6 - LEARNING OBJECTIVE
33. Explain the autonomic...Ch. 20.6 - Prob. 2WDTCh. 20.6 - Prob. 23WDLCh. 20.6 - What is the initial change to blood pressure when...Ch. 20.6 - Prob. 34LOCh. 20.6 - Prob. 35LOCh. 20.6 - Prob. 36LOCh. 20.6 - Prob. 3WDTCh. 20.6 - Prob. 25WDLCh. 20.6 - Prob. 26WDLCh. 20.7 - Prob. 37LOCh. 20.7 - Which organs have an increased proportion of...Ch. 20.8 - Prob. 38LOCh. 20.8 - Prob. 28WDLCh. 20.8 - Prob. 39LOCh. 20.8 - Prob. 29WDLCh. 20.9 - Prob. 40LOCh. 20.9 - Prob. 30WDLCh. 20.9 - Prob. 41LOCh. 20.9 - Prob. 31WDLCh. 20.10 - Prob. 42LOCh. 20.10 - Prob. 43LOCh. 20.10 - LEARNING OBJECTIVE
44. Describe the general...Ch. 20.10 - Prob. 32WDLCh. 20.10 - Prob. 33WDLCh. 20.10 - Prob. 45LOCh. 20.10 - Prob. 46LOCh. 20.10 - Prob. 47LOCh. 20.10 - Prob. 34WDLCh. 20.10 - LEARNING OBJECTIVE
48. Describe the vessels that...Ch. 20.10 - What are the systemic arteries that supply...Ch. 20.10 - Prob. 49LOCh. 20.10 - Prob. 50LOCh. 20.10 - Prob. 51LOCh. 20.10 - Prob. 36WDLCh. 20.10 - Prob. 37WDLCh. 20.10 - Prob. 52LOCh. 20.10 - Prob. 53LOCh. 20.10 - Prob. 38WDLCh. 20.11 - LEARNING OBJECTIVE
54. Trace the arteries of the...Ch. 20.11 - Prob. 55LOCh. 20.11 - Prob. 4WDTCh. 20.11 - Prob. 39WDLCh. 20.11 - Prob. 40WDLCh. 20.11 - Prob. 56LOCh. 20.11 - LEARNING OBJECTIVE
57. Compare and contrast the...Ch. 20.11 - Prob. 41WDLCh. 20.11 - Prob. 42WDLCh. 20.12 - Prob. 58LOCh. 20.12 - List the five structures of fetal circulation, and...Ch. 20.12 - Prob. 59LOCh. 20.12 - Prob. 44WDLCh. 20 - Prob. 1DYBCh. 20 - _____ 2. Which statement is accurate about veins?...Ch. 20 - _____ 3. Vasa vasorum are found in the tunica...Ch. 20 - _____ 4. Which of the following decreases...Ch. 20 - 5. A(n) __________ is a type of vessel with the...Ch. 20 - _____ 6. An increase in _____ will result in an...Ch. 20 - Prob. 7DYBCh. 20 - _____ 8. Velocity of blood flow is the slowest in...Ch. 20 - _____ 9. Blood pressure is regulated by the a....Ch. 20 - _____ 10. Name the correct pathway that blood...Ch. 20 - Prob. 11DYBCh. 20 - Prob. 12DYBCh. 20 - Explain the difference between hydrostatic and...Ch. 20 - Write the formula for determining net filtration...Ch. 20 - Prob. 15DYBCh. 20 - Prob. 16DYBCh. 20 - Briefly explain how changes in cardiac output,...Ch. 20 - Compare how the cardiac center and vasomotor...Ch. 20 - Prob. 19DYBCh. 20 - What postnatal changes occur in the heart and...Ch. 20 - If a patient has cirrhosis of the liver and is...Ch. 20 - Prob. 2CALCh. 20 - Prob. 3CALCh. 20 - Prob. 4CALCh. 20 - Prob. 5CALCh. 20 - Prob. 1CSLCh. 20 - Arteries tend to have a lot of vascular...Ch. 20 - Explain why an overweight individual with high...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education