
Concept explainers
Describe how the process of gene doning results in a cell clone contaning a recombinant plasmid.

To explain: The gene cloning process that produces a cell clone having a recombinant plasmid.
Concept introduction:
To study a particular protein, multiple copies of the gene fragment encoding that protein are synthesized. These gene fragments are then inserted into the expression vector to synthesize a large quantity of protein that is encoded by the gene. This is known as gene cloning.
Explanation of Solution
For cloning a eukaryotic gene, the bacterial plasmid vector and the gene segment to be cloned are cleaved with the same restriction sites. Fig. 1 shows the cloning procedure using EcoRI restriction enzyme as both the sequences have their restriction sites. The arrows between the bases in Fig. 1 represent the restriction sites. The restriction digestion of the linear gene sequence and the plasmid sequence produces sticky ends. The digested gene sequence is ligated into bacterial plasmid and the recombinant plasmid is synthesized. This recombinant plasmid is reintroduced into the host cells (bacteria), where the eukaryotic gene expresses and forms proteins. The bacterial cells containing the recombinant plasmids will divide to form cell clones.
Pictorial representation:
Fig. 1 shows the cloning procedure using a gene sequence and bacterial plasmid.
Fig. 1 Cloning procedure
Want to see more full solutions like this?
Chapter 20 Solutions
Campbell Biology (10th Edition)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Applications and Investigations in Earth Science (9th Edition)
Genetics: From Genes to Genomes
Campbell Essential Biology (7th Edition)
HUMAN ANATOMY
Physics of Everyday Phenomena
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning





