Campbell Biology (10th Edition)
10th Edition
ISBN: 9780321775658
Author: Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 7TYU
Expression of a cloned eukaryotic gene in a bacterial cell involves many challenges. The use of mRNA and reverse transcriptase is part of a strategy to solve the problm of
- (A) post -transcriptional processing.
- (B) post-translational processing.
- (C)
nucleic acid hybridization. - (D) restriction fragment ligation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A) Outline the experimental procedure for cloning a eukaryotic gene and expressing it in
E. coli. Focus on the essential steps starting with eukaryotic gene amplification to
transformation of E. coli cells
B) Explain how insertional inactivation can help you identify the colonies that carry
the plasmid with your eukaryotic gene of interest
C) Plasmids containing antibiotic resistance genes are widely used in gene cloning and
other molecular biology techniques. What would happen if the eukaryotic gene was inserted into
an antibiotic resistance gene on the plasmid?
Which of the following is not true of cDNA produced using human brain tissue as the starting material? (A) It can be amplified by the polymerase chain reaction. (B) It was produced from pre-mRNA using reverse transcriptase. (C) It can be labeled and used as a probe to detect genes expressed in the brain. (D) It lacks the introns of the premRNA
please explain
Chapter 20 Solutions
Campbell Biology (10th Edition)
Ch. 20.1 - Prob. 1CCCh. 20.1 - Prob. 2CCCh. 20.1 - What are some potential difficulties in using...Ch. 20.1 - Prob. 4CCCh. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - Prob. 5TYUCh. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - Prob. 10TYUCh. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 12TYUCh. 20 - Prob. 13TYUCh. 20 - The water in the Yellowstone National Park hot...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
A student moving out of a dormitory crouches in correct fashion to lift a heavy box of books. What prime movers...
HUMAN ANATOMY
What is the difference between histology and radiography?
Human Anatomy (8th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Identify the most mistaken (wrong) choice: a) Transcription machinery and an enhancer can bind to the chromosome at the same time. b) Organic matters may interfere with heat treatment of bacterial growth control. ( c) Nitrocellulose can be used to filter out microorganisms from a liquid solution. d) Time to kill a bacterial culture is not proportional to the number of microbes in the culturearrow_forward1. Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and Bcll. a) Shown below is a BamHI recognition site, which cleaves after the first G. Does cleavage by BamHI result in a 5' or 3' overhang? 5... GGATCC...3' 3...CCTAGG...5' b) Shown below is a Bcll recognition site, which cleaves cleaves after the first T. Does cleavage by , Bcll result in a 5' or 3' overhang? 5... TGATCA...3' 3'... ACTAGT.. 5' You are given the DNA shown below. 5 ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3' 3' TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5' c) If the above DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. d) If the above DNA was cut with Bcll, how many DNA fragments would you expect? Write out the sequence of these double-stranded fragments. e) If you ligate or join the smaller restriction fragment in step c with the smaller restriction fragment in step d, what…arrow_forwardWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forward
- The plasmids from the pUC series are created in the University of California. They carry a lacz gene that plays a significant role in the screening process after transformation. (i) Name the screening process utilizing the lacZ gene. (ii) Elaborate how this gene plays a crucial role in the screening step as mentioned above.arrow_forwardIn generating mutations in a bacterial gene involved in antibiotic resistance, a number of point mutations are isolated that render the bacteria sensitive to the antibiotic. You would like to sequence the gene in order to characterize the mutations, but unfortunately, your lab partner just finished the last of the lab's supply of DNA polymerase. The only things at your disposal are materials for performing a western blot, allowing you to visualize the protein encoded by the gene. How would you identify which mutations are likely to be the result of a missense mutation, which are likely to be the result of a nonsense mutation, and which are likely to be the result of a frameshift mutation?arrow_forward(a) What is Figure 1 in the Zheng et al paper showing? Describe it in your own words. (b) What are some sections of the Zheng paper that are re-arranged or different than you might expect in a primary research article. Is this still primary research? (c) How did the author use CRISPR to alter the butterfly wing expression? What was the result of this use of CRISPR?arrow_forward
- Mutagenesis is a technique in which genetic information of an organism is altered in a stable manner resulting in a mutation. It may occur spontaneously in nature of as a result of exposure to mutagens. It can also be achieved experimentally using optimized laboratory procedures. (i) (ii) What is site directed mutagenesis (SDM)? Explain how SDM can assist in the integration of a His-tag at the end of your gene of interest.arrow_forward1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were used to create these sequences? b) Could the sequences below be hybridized and ligated? c) If it is possible to join these two sequences by hybridization and ligation what would happen if the resulting sequence was again exposed to the original restriction enzyme(s) that you identified? You must defend any answers that you make with logic at the level of course content. i. 5'-G 3'-CCTAG ii. GATCT-3' A-5'arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forward
- After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forwardBriefly compare (a) restriction enzymes, (b) engineered nucleases and (c) CRISPR-Cas in terms of their origin, nature, and mechanism.arrow_forwardThe human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat different in its amino acid sequence. You have obtained a mutant bacterial strain in which the gene for hexokinase is missing. If you introduce into your mutant strain a DNA plasmid engineered to contain the DNA coding sequence of the human hexokinase gene, what must you also include? a)The human hexokinase promoter b)The bacterial hexokinase promoter c)Both the human and bacterial promoters d)You cannot engineer a bacteria to produce a human enzymearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License