Brock Biology of Microorganisms (15th Edition)
15th Edition
ISBN: 9780134261928
Author: Michael T. Madigan, Kelly S. Bender, Daniel H. Buckley, W. Matthew Sattley, David A. Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 19.1, Problem 1MQ
- Describe the enrichment strategy behind Beijerinck’s isolation of Azotobacter.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 19 Solutions
Brock Biology of Microorganisms (15th Edition)
Ch. 19.1 - Describe the enrichment strategy behind...Ch. 19.1 - Why is sulfate (So42) added to a Winogradsky...Ch. 19.1 - What is enrichment bias? How does dilution reduce...Ch. 19.1 - Why do the results of a direct enrichment of an...Ch. 19.2 - What is a pure culture and why is obtaining one...Ch. 19.2 - How does the agar dilution method differ from...Ch. 19.2 - What criteria serve to demonstrate that a culture...Ch. 19.3 - How might you isolate a morphologically unique...Ch. 19.3 - What is meant by high-throughput in culturing...Ch. 19.3 - What feature of high-throughput culturing relieves...
Ch. 19.4 - How does viability staining differ from stains...Ch. 19.4 - What types of environments limit the application...Ch. 19.4 - Why is it incorrect to say that the GFP is a...Ch. 19.4 - Prob. 1CRCh. 19.5 - What structure in the cell is the target for...Ch. 19.5 - FISH and CARD-FISH can be used to reveal different...Ch. 19.5 - Why is CARD-FISH more suitable than FISH for...Ch. 19.6 - What could you conclude from PCR/DGGE analysis of...Ch. 19.6 - What surprising finding has come out of many...Ch. 19.6 - How has next-generation sequencing technology...Ch. 19.6 - QWhich method, ARISA or T-RFLP, would provide more...Ch. 19.7 - Prob. 1MQCh. 19.7 - What are the advantages and disadvantages of...Ch. 19.7 - Why might a microarray be superior to using...Ch. 19.8 - Prob. 1MQCh. 19.8 - How do environmental genomic approaches differ...Ch. 19.8 - Prob. 3MQCh. 19.8 - Prob. 1CRCh. 19.9 - Prob. 1MQCh. 19.9 - If a large pulse of organic matter entered the...Ch. 19.9 - Q What are the major advantages of radioisotopic...Ch. 19.10 - What is the simplest explanation for why lunar...Ch. 19.10 - What is the expected isotopic composition of...Ch. 19.10 - How might exchange of metabolites among members of...Ch. 19.10 - Will autotrophic organisms contain more or less...Ch. 19.11 - How could NanoSIMS be used to identify a...Ch. 19.11 - Prob. 2MQCh. 19.11 - How does MAR-FISH link microbial diversity and...Ch. 19.11 - Q What can MAR-FISH tell you that FISH alone...Ch. 19.12 - How can stable isotope probing reveal the identity...Ch. 19.12 - What key method is required to do genomics on a...Ch. 19.12 - Prob. 3MQCh. 19.12 - How would you use cytometric cell sorting to...Ch. 19 - Design an experiment for measuring the activity of...Ch. 19 - You wish to know whether Archaea exist in a lake...Ch. 19 - Design an experiment to solve the following...Ch. 19 - Design a SIP experiment that would allow you to...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Plants use the process of photosynthesis to convert the energy in sunlight to chemical energy in the form of su...
Campbell Essential Biology with Physiology (5th Edition)
The distances you obtained in Question 3 are for only one side of the ridge. Assuming that a ridge spreads equa...
Applications and Investigations in Earth Science (9th Edition)
APPLY 1.2 Express the following quantities in scientific notation
using fundamental SI units of mass and lengt...
Chemistry (7th Edition)
Write a molecular equation for the precipitation reaction that occurs (if any) when each pair of solutions is m...
Introductory Chemistry (6th Edition)
Match each of the following items with all the terms it applies to:
Human Physiology: An Integrated Approach (8th Edition)
1.3 Obtain a bottle of multivitamins and read the list of ingredients. What are four chemicals from the list?
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemical Tests-Part 1; Author: Southern Stacker;https://www.youtube.com/watch?v=a-i9vANfQWQ;License: Standard Youtube License