
Human Anatomy & Physiology
1st Edition
ISBN: 9780805382952
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18.4, Problem 1QC
Describe the structure and size of a typical capillary.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 18 Solutions
Human Anatomy & Physiology
Ch. 18.1 - Define the three types of blood vessels in the...Ch. 18.1 - Prob. 2QCCh. 18.1 - Prob. 3QCCh. 18.1 - Prob. 4QCCh. 18.1 - Prob. 5QCCh. 18.1 - 6. How do veins differ structurally and...Ch. 18.1 - Prob. 7QCCh. 18.1 - What are venous valves, and what are their...Ch. 18.1 - Prob. 9QCCh. 18.2 - Prob. 1QC
Ch. 18.2 - Prob. 2QCCh. 18.2 - Prob. 3QCCh. 18.2 - Prob. 4QCCh. 18.2 - Prob. 5QCCh. 18.2 - Prob. 6QCCh. 18.2 - 7. How does mean arterial pressure differ from...Ch. 18.2 - Prob. 8QCCh. 18.2 - Prob. 9QCCh. 18.3 - Prob. 1QCCh. 18.3 - Prob. 2QCCh. 18.3 - Prob. 3QCCh. 18.3 - Prob. 4QCCh. 18.3 - Prob. 5QCCh. 18.3 - Prob. 6QCCh. 18.3 - Prob. 7QCCh. 18.3 - 8. What is circulatory shock, and why is it...Ch. 18.4 - Describe the structure and size of a typical...Ch. 18.4 - 2. List three ways in which substances may cross...Ch. 18.4 - 3. Describe the properties of the three types of...Ch. 18.4 - 4. What is tissue perfusion?
Ch. 18.4 - Prob. 5QCCh. 18.4 - Prob. 6QCCh. 18.4 - Prob. 7QCCh. 18.4 - Prob. 8QCCh. 18.4 - Prob. 9QCCh. 18.5 - What is hydrostatic pressure? How does hydrostatic...Ch. 18.5 - 2. In which direction does the hydrostatic...Ch. 18.5 - Prob. 3QCCh. 18.5 - Prob. 4QCCh. 18.5 - Where in the capillary does net filtration take...Ch. 18.5 - Prob. 6QCCh. 18.6 - List the three branches of the aortic arch.Ch. 18.6 - Prob. 2QCCh. 18.6 - Prob. 3QCCh. 18.6 - Prob. 4QCCh. 18.6 - Which arteries supply the anterior and posterior...Ch. 18.6 - Prob. 6QCCh. 18.6 - Which artery supplies the upper limb?Ch. 18.6 - Trace the arterial supply of the upper limb from...Ch. 18.6 - 9. Which artery supplies the lower limb?
Ch. 18.6 - Trace the arterial supply of the lower limb from...Ch. 18.6 - Prob. 11QCCh. 18.7 - Where do most veins superior to the diaphragm...Ch. 18.7 - Prob. 2QCCh. 18.7 - Where are the dural sinuses located? What drains...Ch. 18.7 - How does drainage of the posterior body wall...Ch. 18.7 - 5. Which abdominal vessels drain straight into...Ch. 18.7 - Prob. 6QCCh. 18.7 - Prob. 7QCCh. 18.7 - Prob. 8QCCh. 18.7 - Prob. 9QCCh. 18.7 - Prob. 10QCCh. 18 - Prob. 1CYRCh. 18 - Locations where vessels connect via collateral...Ch. 18 - Prob. 3CYRCh. 18 - 4. Which of the following factors would increase...Ch. 18 - Which of the following would produce a decrease in...Ch. 18 - Fill in the blanks: The two pressures within the...Ch. 18 - The lowest pressure in the systemic circuit occurs...Ch. 18 - Explain the mechanisms that assist in the return...Ch. 18 - Mark the following statements as true or false. If...Ch. 18 - The carotid sinus contains: a. baroreceptors. b....Ch. 18 - Capillaries consist of: a. three thin tunics. b....Ch. 18 - List three ways in which substances can cross the...Ch. 18 - Which of the following structures is the leakiest?...Ch. 18 - Prob. 14CYRCh. 18 - 15. The hydrostatic pressure gradient drives water...Ch. 18 - Prob. 16CYRCh. 18 - Match the following arteries with the correct...Ch. 18 - Which of the following is not a common pulse...Ch. 18 - 19. Which of the following vessels does not drain...Ch. 18 - Match the following veins with the correct...Ch. 18 - 1. Explain why a severed artery spurts blood,...Ch. 18 - 2. Explain why a person who is 7 feet tall is...Ch. 18 - Prob. 3CYUCh. 18 - Prob. 1AYKACh. 18 - Prob. 2AYKACh. 18 - Predict the effects of each of the following on...Ch. 18 - Prob. 4AYKBCh. 18 - Ms. Rodgers has been diagnosed with secretion of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning
Dissection Basics | Types and Tools; Author: BlueLink: University of Michigan Anatomy;https://www.youtube.com/watch?v=-_B17pTmzto;License: Standard youtube license