
a.
To determine:
Mutation 1: A transition at
a.

Explanation of Solution
Transition mutation is a type of base-substitution mutation in which either a purine base is replaced with different purine base or pyrimidine base is replaced with different pyrimidine base. Due to transition mutation at nucleotide 11, the DNA template formed is
b.
To determine:
Mutation 2: A transition at nucleotide 13 in a given nucleotide sequence of
b.

Explanation of Solution
In transition mutation, a purine base is replaced by different purine base and pyrimidine base is replaced by different pyrimidine base. The transition at 13 nucleotides of DNA sequence results
c.
To determine:
Mutation 3: A one-nucleotide deletion at nucleotide 7 in a given nucleotide sequence of
c.

Explanation of Solution
In deletion mutation, removal of single nucleotide results in a frameshift mutation that changes the reading frame. After deletion of the nucleotide at 7 positions the DNA sequence formed is
d.
To determine:
Mutation 4: A
d.

Explanation of Solution
In transversion mutation a pyrimidine base is replaced with purine base or purine base is replaced with pyrimidine base. After transversion of
e.
To determine:
Mutation 5: An addition of TGG after nucleotide 6 in a given nucleotide sequence of
e.

Explanation of Solution
Addition of nucleotide in a DNA sequence results in a change in codon sequence that codes for different protein. On addition of TCG after 6 nucleotide DNA sequence is
f.
To determine:
Mutation 6: A transition at nucleotide 9 in a given nucleotide sequence of
f.

Explanation of Solution
Transition mutation involves the replacement of a purine with purine or pyrimidine with a pyrimidine. In this transition at nucleotide 9 forms, the DNA sequence is
The mutation causes the change of sequence of nucleotide (one base) in a gene or a chromosome. A change in nucleotide at 11 position results in the coding of amino acid serine. Mutation at nucleotide 13 results in a stop codon. Deletion of the nucleotide at 7 results in the coding of alanine. Transversion of
Want to see more full solutions like this?
Chapter 18 Solutions
Genetics: A Conceptual Approach
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





