
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.8, Problem 6MC
Summary Introduction
To determine:
The differences between chelicerates and mandibulaes.
Introduction:
Phylum Arthropoda is the most diverse phylum of Kingdom Animalia. There are 17,000 species in the phylum Arthropoda. Chelicerates and mandibulates are the major families of this phylum.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 17 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 17.1 - Prob. 1MCCh. 17.1 - Prob. 2MCCh. 17.1 - What features were used to build the animal...Ch. 17.1 - Prob. 4MCCh. 17.1 - Prob. 5MCCh. 17.1 - What advantages does segmentation confer?Ch. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - Prob. 3MCCh. 17.2 - Prob. 4MC
Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.3 - Prob. 4MCCh. 17.4 - Prob. 1MCCh. 17.4 - How does the body shape of a flatworm enhance gas...Ch. 17.4 - Prob. 3MCCh. 17.4 - Prob. 4MCCh. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17.5 - Prob. 3MCCh. 17.6 - What features do all annelids share?Ch. 17.6 - List examples of animals in each of the two...Ch. 17.6 - Prob. 3MCCh. 17.7 - Prob. 1MCCh. 17.7 - Prob. 2MCCh. 17.7 - Prob. 3MCCh. 17.7 - Prob. 4MCCh. 17.8 - Prob. 1MCCh. 17.8 - Prob. 2MCCh. 17.8 - Prob. 3MCCh. 17.8 - Prob. 4MCCh. 17.8 - Prob. 5MCCh. 17.8 - Prob. 6MCCh. 17.9 - What characteristics distinguish the echinoderms?Ch. 17.9 - Prob. 2MCCh. 17.9 - In what ways are echinoderms important?Ch. 17.10 - Prob. 1MCCh. 17.10 - Prob. 2MCCh. 17.10 - Prob. 3MCCh. 17.10 - Prob. 4MCCh. 17.11 - What is the relationship among tunicates,...Ch. 17.11 - Make a table comparing the features of each...Ch. 17.11 - Prob. 3MCCh. 17.11 - Prob. 4MCCh. 17.12 - Prob. 1MCCh. 17.12 - What can skeletal anatomy and DNA sequences in...Ch. 17.12 - What are the four groups of species in the hominin...Ch. 17.12 - Prob. 4MCCh. 17 - Following gastrulation, the cells that have folded...Ch. 17 - Prob. 2MCQCh. 17 - Prob. 3MCQCh. 17 - How is the body structure of an annelid different...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Echinoderms have ____ symmetry as embryos and ____...Ch. 17 - Prob. 8MCQCh. 17 - Which of the following has pharyngeal slits at...Ch. 17 - Lobe-finned fishes are important because they a...Ch. 17 - To which of the following is a salamander most...Ch. 17 - How do reptiles and mammals differ from...Ch. 17 - Which of the following represents the correct...Ch. 17 - Primates share all of the following...Ch. 17 - DNA evidence suggests that modern humans a. share...Ch. 17 - Compare the nine major animal phyla in the order...Ch. 17 - Prob. 2WIOCh. 17 - Using the evolutionary trees in this chapter,...Ch. 17 - Prob. 4WIOCh. 17 - Prob. 5WIOCh. 17 - Prob. 6WIOCh. 17 - Prob. 7WIOCh. 17 - Create lists of animal phyla that a are...Ch. 17 - Prob. 9WIOCh. 17 - Draw from memory a phylogenetic tree that traces...Ch. 17 - Prob. 11WIOCh. 17 - List the evidence that biologists use to classify...Ch. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Prob. 16WIOCh. 17 - Prob. 17WIOCh. 17 - Prob. 18WIOCh. 17 - In what ways has culture been an important factor...Ch. 17 - Prob. 20WIOCh. 17 - How do you predict a scientist would respond to a...Ch. 17 - Prob. 22WIOCh. 17 - Prob. 1SLCh. 17 - Prob. 2SLCh. 17 - Prob. 1PITCh. 17 - Prob. 2PITCh. 17 - Draw a concept map that summarizes the chordates,...Ch. 17 - Add tunicates, hagfishes, birds, monotremes,...Ch. 17 - Other than the ones pictured, give an example of a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College