
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
3rd Edition
ISBN: 9781260670929
Author: Hoefnagels
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.6, Problem 3MC
Summary Introduction
To determine:
The process by which animals take food, exchange gases, and move.
Introduction:
Earthworms, leeches, and other segmented worms are known as annelids. Leeches and earthworms are hermaphrodites, so each has the reproductive organs of both sexes.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 17 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Ch. 17.1 - Prob. 1MCCh. 17.1 - Prob. 2MCCh. 17.1 - What features were used to build the animal...Ch. 17.1 - Prob. 4MCCh. 17.1 - Prob. 5MCCh. 17.1 - What advantages does segmentation confer?Ch. 17.2 - Prob. 1MCCh. 17.2 - Prob. 2MCCh. 17.2 - Prob. 3MCCh. 17.2 - Prob. 4MC
Ch. 17.3 - Prob. 1MCCh. 17.3 - Prob. 2MCCh. 17.3 - Prob. 3MCCh. 17.3 - Prob. 4MCCh. 17.4 - Prob. 1MCCh. 17.4 - How does the body shape of a flatworm enhance gas...Ch. 17.4 - Prob. 3MCCh. 17.4 - Prob. 4MCCh. 17.5 - Prob. 1MCCh. 17.5 - Prob. 2MCCh. 17.5 - Prob. 3MCCh. 17.6 - What features do all annelids share?Ch. 17.6 - List examples of animals in each of the two...Ch. 17.6 - Prob. 3MCCh. 17.7 - Prob. 1MCCh. 17.7 - Prob. 2MCCh. 17.7 - Prob. 3MCCh. 17.7 - Prob. 4MCCh. 17.8 - Prob. 1MCCh. 17.8 - Prob. 2MCCh. 17.8 - Prob. 3MCCh. 17.8 - Prob. 4MCCh. 17.8 - Prob. 5MCCh. 17.8 - Prob. 6MCCh. 17.9 - What characteristics distinguish the echinoderms?Ch. 17.9 - Prob. 2MCCh. 17.9 - In what ways are echinoderms important?Ch. 17.10 - Prob. 1MCCh. 17.10 - Prob. 2MCCh. 17.10 - Prob. 3MCCh. 17.10 - Prob. 4MCCh. 17.11 - What is the relationship among tunicates,...Ch. 17.11 - Make a table comparing the features of each...Ch. 17.11 - Prob. 3MCCh. 17.11 - Prob. 4MCCh. 17.12 - Prob. 1MCCh. 17.12 - What can skeletal anatomy and DNA sequences in...Ch. 17.12 - What are the four groups of species in the hominin...Ch. 17.12 - Prob. 4MCCh. 17 - Following gastrulation, the cells that have folded...Ch. 17 - Prob. 2MCQCh. 17 - Prob. 3MCQCh. 17 - How is the body structure of an annelid different...Ch. 17 - Prob. 5MCQCh. 17 - Prob. 6MCQCh. 17 - Echinoderms have ____ symmetry as embryos and ____...Ch. 17 - Prob. 8MCQCh. 17 - Which of the following has pharyngeal slits at...Ch. 17 - Lobe-finned fishes are important because they a...Ch. 17 - To which of the following is a salamander most...Ch. 17 - How do reptiles and mammals differ from...Ch. 17 - Which of the following represents the correct...Ch. 17 - Primates share all of the following...Ch. 17 - DNA evidence suggests that modern humans a. share...Ch. 17 - Compare the nine major animal phyla in the order...Ch. 17 - Prob. 2WIOCh. 17 - Using the evolutionary trees in this chapter,...Ch. 17 - Prob. 4WIOCh. 17 - Prob. 5WIOCh. 17 - Prob. 6WIOCh. 17 - Prob. 7WIOCh. 17 - Create lists of animal phyla that a are...Ch. 17 - Prob. 9WIOCh. 17 - Draw from memory a phylogenetic tree that traces...Ch. 17 - Prob. 11WIOCh. 17 - List the evidence that biologists use to classify...Ch. 17 - Prob. 13WIOCh. 17 - Prob. 14WIOCh. 17 - Prob. 15WIOCh. 17 - Prob. 16WIOCh. 17 - Prob. 17WIOCh. 17 - Prob. 18WIOCh. 17 - In what ways has culture been an important factor...Ch. 17 - Prob. 20WIOCh. 17 - How do you predict a scientist would respond to a...Ch. 17 - Prob. 22WIOCh. 17 - Prob. 1SLCh. 17 - Prob. 2SLCh. 17 - Prob. 1PITCh. 17 - Prob. 2PITCh. 17 - Draw a concept map that summarizes the chordates,...Ch. 17 - Add tunicates, hagfishes, birds, monotremes,...Ch. 17 - Other than the ones pictured, give an example of a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College