
EBK HUMAN ANATOMY & PHYSIOLOGY
16th Edition
ISBN: 8220100659836
Author: AMERMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 17.5, Problem 6QC
Summary Introduction
To review:
The effects of sympathetic nervous system on cardiac output.
Introduction:
Sympathetic nervous system innervates the heart through a set of sympathetic nerves that arise from ganglia located along the spinal cord. It releases some hormones that can alter the cardiac output.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 17 Solutions
EBK HUMAN ANATOMY & PHYSIOLOGY
Ch. 17.1 - Where is the heart located, and how large is it?Ch. 17.1 - What are the hearts upper and lower chambers...Ch. 17.1 - 3. From what sources does blood flow into the...Ch. 17.1 - 4. Which side of the heart is considered the...Ch. 17.1 - Which side of the heart is considered the systemic...Ch. 17.2 - Prob. 1QCCh. 17.2 - Prob. 2QCCh. 17.2 - 3. What are the three layers of the heart wall,...Ch. 17.2 - 4. What are the four main great vessels? From...Ch. 17.2 - How do the right and left ventricles differ in...
Ch. 17.2 - 6. Why do you think it is important to ensure via...Ch. 17.2 - 7. What is the overall pathway of blood flow...Ch. 17.2 - Prob. 4QCCh. 17.2 - Prob. 5QCCh. 17.2 - Prob. 6QCCh. 17.3 - How do pacemaker and contractile cells differ?...Ch. 17.3 - 2. What are intercalated discs? What is their...Ch. 17.3 - Prob. 5QCCh. 17.3 - Prob. 6QCCh. 17.3 - What is the sequence of events of a contractile...Ch. 17.3 - How does the refractory period of cardiac muscle...Ch. 17.3 - 7. What does an ECG record?
Ch. 17.3 - What are the five waves in an ECG, and what do...Ch. 17.4 - What causes the heart sounds S1 and S2?Ch. 17.4 - Prob. 2QCCh. 17.4 - Prob. 3QCCh. 17.4 - Is the end-diastolic or the end-systolic volume of...Ch. 17.4 - 5. Walk through the mechanical events of the...Ch. 17.4 - How do the ECG waves correlate with each part of...Ch. 17.4 - 7. How does the left ventricular pressure...Ch. 17.5 - Prob. 1QCCh. 17.5 - What is cardiac output? How does it relate to...Ch. 17.5 - Prob. 3QCCh. 17.5 - What is the Frank-Starling law, and how does it...Ch. 17.5 - What is a chronotropic agent?Ch. 17.5 - Prob. 6QCCh. 17.5 - 7. What effects does the parasympathetic nervous...Ch. 17.5 - How would a hormone that decreases the amount of...Ch. 17.5 - How is heart failure defined?Ch. 17 - 1. Mark the following statements as true or false....Ch. 17 - 2. The pericardial cavity is located between:
a....Ch. 17 - 3. Which of the following statements is true?
a....Ch. 17 - Match the following terms with the correct...Ch. 17 - Fill in the blanks: The coronary arteries are the...Ch. 17 - 6. How do pacemaker cardiac muscle cells differ...Ch. 17 - 7. Cardiac muscle cells are joined by structures...Ch. 17 - Prob. 8CYRCh. 17 - Prob. 9CYRCh. 17 - 10. The _________is the primary pacemaker of the...Ch. 17 - The AV node delay: a. allows the atria and...Ch. 17 - Explain what each of the following terms...Ch. 17 - 13. Mark the following statements as true or...Ch. 17 - Prob. 14CYRCh. 17 - 15. Fill in the blanks: The first heart sound is...Ch. 17 - Cardiac output is equal to: a. end-diastolic...Ch. 17 - Prob. 17CYRCh. 17 - 18. Which of the following statements is false?
a....Ch. 17 - 1. A birth defect called transposition of great...Ch. 17 - 2. Predict which would be more damaging to...Ch. 17 - 3. When the SA node doesn’t function properly, the...Ch. 17 - Prob. 4CYUCh. 17 - Prob. 1AYKACh. 17 - You are a nursing student in a hospital, and a...Ch. 17 - Prob. 3AYKACh. 17 - Prob. 4AYKB
Knowledge Booster
Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning