CAMPBELL BIOLOGY,VOL.II >CUSTOM<
CAMPBELL BIOLOGY,VOL.II >CUSTOM<
17th Edition
ISBN: 9781323803677
Author: Urry
Publisher: PEARSON
Question
Book Icon
Chapter 17.1, Problem 3CC
Summary Introduction

To draw: The mRNA sequence transcribed from the non-template strand of a gene as well as its translated sequence.

Concept introduction:

The genetic information of DNA is encrypted in the nucleotide base sequences. These sequences are transcribed into mRNA triplets and are called codons. These mRNA triplet nucleotides are then translated to form a polypeptide.

Blurred answer
Students have asked these similar questions
A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate sequence could be transcribed instead of the template sequence.  Draw the nontemplate sequence in 3’-5’ order (because remember you have to flip it for your brain to read it like RNA Polymerase would J).  Then draw the mRNA sequence and translate it using Figure 14.6 (or any codon chart).  Predict how well the protein synthesized from the nontemplate strand would function if at all.
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
Using the provided coding strand below: 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the mRNAstrand for the coding strand above. Type your answer in the box below. Use two dash lines in between the 5 and your first base, and two dash line between your last base and before 3' (follow formatting above). What is your Start codon? What is your Stop codon? 5-AUGGCCGGGCCAAUAGAAUAG-3 AUGGCCGGGCCAAUAGAAUAG

Chapter 17 Solutions

CAMPBELL BIOLOGY,VOL.II >CUSTOM<

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning