CAMPBELL BIOLOGY,VOL.II >CUSTOM<
17th Edition
ISBN: 9781323803677
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 6TYU
Using Figure 17.6, identify a 5' → 3' sequence of
(A) 5'-UUUCCCAAA-3'
(B) 5'-GAACCCCTT-3'
(C) 5'- CTTCGGGAA-3'
(D) 5'-AAACCCUUU-3'
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5'
A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps.
B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each.
C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’
1. What type of point mutation is it?
2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
Chapter 17 Solutions
CAMPBELL BIOLOGY,VOL.II >CUSTOM<
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Which of the following is not true of a codon? (A)...Ch. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Which of the following is not true of RNA...Ch. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
2. Which of the following is the best example of the use of a referent? _
a. A red bicycle
b. Big as a dump tru...
Physical Science
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach
On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
Human Physiology: An Integrated Approach (8th Edition)
56. Global Positioning System. Learn more about the global positioning system and its uses. Write a short repo...
The Cosmic Perspective (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardNonearrow_forwardc) Based on your answer to part b above, determine the polypeptide sequence produced by the ribosome from the mRNA which you transcribedarrow_forward
- A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH|arrow_forward( plz give in detail )arrow_forwarda) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forward
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardThe following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forward(i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1arrow_forward
- Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardGiven the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'arrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY