
To explain: The accuracy of the statement “A pregnant woman must do everything for two”.
Introduction: Gestation or pregnancy is a period during which the offspring develops within the uterus of a sexually mature woman. This involves several developmental stages of the fetus. In humans, pregnancy is nearly nine months long, divided into three trimesters, involving several changes in the mother and the growing fetus.
To give: Some specifics to support the statement “A pregnant woman must do everything for two”.
Introduction: Gestation or pregnancy is a period during which the offspring develops within the uterus of a sexually mature woman. This involves several developmental stages of the fetus. In humans, pregnancy is nearly nine months long, divided into three trimesters, involving several changes in the mother and the growing fetus.

Want to see the full answer?
Check out a sample textbook solution
Chapter 17 Solutions
Human Biology (MindTap Course List)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningMicrobiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning

