Biology
12th Edition
ISBN: 9781260494570
Author: Raven, Peter
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 17, Problem 1A
Summary Introduction
Introduction: Polymerase chain reaction (PCR) is a technique used to amplify a particular DNA sequence. Reverse transcriptase quantitative PCR (RT-qPCR) is one of the easiest and fastest methods used to measure relative changes in the expression of the gene.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference
Northern blots are valuable tools to analyze the mRNA level present in a sample. Describe an experiment that uses the Northern blot as a tool and how you would visualize the mRNA giving at least two examples of probe types.
Chapter 17 Solutions
Biology
Ch. 17.1 - Prob. 1LOCh. 17.1 - Prob. 2LOCh. 17.1 - Describe the construction and uses of recombinant...Ch. 17.2 - Relate the process of DNA replication to PCR.Ch. 17.2 - Compare and contrast PCR, RT-PCR, and quantitative...Ch. 17.3 - Prob. 1LOCh. 17.3 - Prob. 2LOCh. 17.3 - Describe the pros and cons of RNA interference and...Ch. 17.4 - Explain how the universal nature of the genetic...Ch. 17.4 - Compare and contrast knockout, knockin, and...
Ch. 17.4 - Prob. 3LOCh. 17.5 - Describe the benefits of biofuel production from...Ch. 17.5 - Prob. 2LOCh. 17.5 - Prob. 3LOCh. 17.6 - Prob. 1LOCh. 17.6 - Compare and contrast FISH and gene chip...Ch. 17.6 - Describe how immunoassays can be used to diagnose...Ch. 17.7 - Describe the benefits of creating transgenic...Ch. 17.7 - Prob. 2LOCh. 17.7 - Evaluate issues on each side of the transgenic...Ch. 17 - Prob. 1DACh. 17 - Prob. 2DACh. 17 - Prob. 1IQCh. 17 - Prob. 2IQCh. 17 - You study a gene known to be important in the...Ch. 17 - What is the basis of separation of different DNA...Ch. 17 - Prob. 3UCh. 17 - FISH analysis of a breast tumor biopsy for HER2...Ch. 17 - In terms of studying gene function, what is the...Ch. 17 - The Ti plasmid of Agrobacterium usually induces...Ch. 17 - Prob. 1ACh. 17 - Which of the following statements is accurate for...Ch. 17 - Prob. 3ACh. 17 - Many human proteins, such as hemoglobin, are only...Ch. 17 - Amyloid beta is a proteolytic product of a protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Nuclear (N) and cytoplasmic (C) mRNA samples of a gene with 2 exons and one intron run on an agarose gel along with a size marker, are shown in the gel figure below. Ntds = nucleotides 3. What is the length of the primary mRNA? HINT: Check question 3c RNA sample: N a. C ntds 1900- b. What is the length of the processed MRNA? 1250 1000 800- 650 с. If the 1250 nucleotide and 650 nucleotide fragments are spliced mRNA intermediates as indicated in the splicing diagram below, what is the size in nucleotides of Exon 1 & Exon 2. Size 1 Markers Exon Intran Exon pre-MRNA AG GU (1) (2) I spliced MRNA 2.arrow_forwardChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’arrow_forwardYou synthesized 3 pre-mRNAs, as shown, performed splicing in a test tube, and monitored the splicing reaction on a gel by autoradiography. What can you conclude from this data? Select all that apply. You may select multiple options. These pre-mRNAs were incubated with a nuclear extract and splicing over time (0-120 min) was followed by gel electrophoresis. m7GpppG 0 30 60 120 O None of these options m'Gppp 13- Gppp 13- (uncapped)13- GpppG 0 30 60 120 O Cap affects the splicing of the second intron O Cap affects the splicing of the first intron Cap affects splicing of all introns Cap has no effect on splicing exon intron uncapped 0 30 60 120 min Fig. 15.29 13 14 13 14 15 (0) 15 13 14 13 14 15 (4) 15 (0) Fig. 15.30arrow_forward
- In a competitive RNA microarray experiment, you hybridize two samples to the same chip. Before hybridization, sample A is labeled with red fluorescence and Sample B is labeled with green fluorescence. Spot 1142 is yellow. What does this tell you about the relative abundance of the mRNA corresponding to this spot in the two samples? Group of answer choices It is equally abundant in both samples A and B. It is more abundant in B than A. It is more abundant in A than B. It is not present in either A or B.arrow_forwardA peptide is produced in two different cells. The primary structure is the same in both cells, but the amount of peptide is increased in one cell. What could be happening to the pre-mRNA or mRNA transcript within the cell that has the higher amount of this peptide? A. It has a shorter Poly-A tail B. An alternative polyadenylation (Poly-A) site is being selected C. Leaky scanning occurred D. B and C are both correct OE. None of the abovearrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forward
- You need to determine if a specific mRNA is modified. What method will you choose to determine this and why?arrow_forwardFor each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence). Process most immediately affected by deletion RNA Sequence deleted Replication Transcription Translation processing a. ori site b. 3' splice site consensus c. Poly(A) tail d. Terminator e. Start codon f. -10 consensus g. Shine-Dalgarnoarrow_forwardDesign a strategy to make a subtracted-complete cDNA library from liver cells. Use a flowchart method to propose how this objective can be accomplished. The sizes of mRNA range from 2 kb to 15 kb. Briefly indicate your reasons for the sequence of steps..arrow_forward
- You sequence a gene of interest and isolate the matching mRNA. You find that the mRNA is considerably shorter than the DNA sequence. Why is that?arrow_forwardIn 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? (More than one may apply). A. Synthetic mRNA B. DNA C. Anti-codons D. Radioactive amino acids E. Large ribosomal subunits F. Small ribosomal subunitsarrow_forwardProcedure This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the following sequences of the first thirty (30) nucleotides: TAC CAC GTG GAC TGA GGA CAC CTC TTC AGA... 1. First transcribe the DNA sequence into the mRNA sequence. 2. Refer to the genetic code to write down the amino acid sequence that these 30 nucleotides encode beginning with the first nucleotide. 3. Generate a random number (1-30) by drawing lots in a bowl. Then locate the DNA nucleotide to "mutate" using the number drawn as the position along the gene. 4. "Roll" the tetrahedron "mutator" dice (see direction below for making the tetrahedron "mutator" dice). Note the letter on the side that is flat on the table. That is the nucleotide that will replace the nucleotide in the DNA at the position decided in the previous step. 5. Write the mutant nucleotide sequence in the row for Mutation 1, then analyze mutation. a. If it is the same nucleotide, write same nucleotide…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY