Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 10TYU
EVOLUTION CONNECTION Some bacteria may be able to respond to environmental stress by increasjng the rate at which mutations occur during cell division. How might this be accomplished? Might there be an evolutionary advantage to this ability? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?
In the:
Mutation of the template gene such that an ACC was converted to ATC.
Explain: (a) What is the process affected?
(b) What is the Effect on the process?
(c) Does it affect prokaryotes, eukaryotes or both?
Experiment:
In this activity yo Page 5
ze the results of experiments that investigate nutritional requirement of
several mutant strains of yeast. The mutations in these strains cause a nutritional requirement for an
amino acid, such that the strains will not grow in media that lack one specific amino acid. Any mutant
that has a nutritional requirement is called an auxotroph, and is incapable of growing in a "minimal
medium" containing only a carbon source (e.g., glucose), a simple nitrogen source (e.g., ammonium
sulfate), and various salts and minerals. Such strains can be supported on a medium supplemented
with only the missing nutrient or on a "rich" medium that contains amino acids, vitamins, nitrogenous
bases, etc. (often in the form of an extract from yeast). The wild-type individual that can synthesize
the metabolic component is a prototroph, and is capable of growth on minimal medium.
The mutant strains in this activity are unable to synthesize tryptophan, lysine, or histidine;…
Chapter 16 Solutions
Campbell Biology: Custom Edition
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - What two properties, one structural and one...Ch. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Describe the levels of chromatin packing you'd...Ch. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Practice Problem ATTEMPT
Write the rate expressions for each of the following reactions:
(a)
(b)
(c)
Chemistry
What process causes the Mediterranean intermediate Water MIW to become more dense than water in the adjacent At...
Applications and Investigations in Earth Science (9th Edition)
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Describe the role and impact of microbes on the earth.
Microbiology Fundamentals: A Clinical Approach
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have isolated a strain of mutant yeast cells that divide normally at 25 degrees Celsius but cannot ente4 M phase at 37 degrees Celsius. You found that the gene for M cdk is not mutated. Which of the following temperatures sensitive mutations could be responsible for the.behavior of this strain of yeast? Inactivated of an enzyme that normally degrades m cyclin; Inactivated of a protein that normally triggers the synthesis of m cyclin; Inactivated of a protein kinase that normally Inactivate the cdk; none 2. Which of the following statements about the anaphase promoting complex is false? It promotes the degradation of proteins that activates mitosis; it inhibits m cdk activities; it becomes active at the very beginning of metaphase; it is activated by m cdk 3. During cancer development:.? Cells accumulate mutations in a fixed order which results in increase rate of cell division; the inheritance of mutations caused by dna damage is essential for cancer progression; there is typically…arrow_forwardAa v A A nt Paragraph Styles Nocodazole is a potent inhibitor of microtubule polymerization, which is required for formation of the mitotic spindle. By treating a population of mammalian cells with nocodazole for a time and then washing it out of the medium, we can synchronize the cell population. In the presence of nocodazole, where in the cell cycle do you expect the cells to accumulate? What mechanism do you think is responsible for stopping cell-cycle progression when cells are treated with nocodazole? D Focus COUarrow_forwardExplain why they qualify as machines based on their functions and component molecules.arrow_forward
- E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWERarrow_forwardEukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardMutations in genes that change their pattern of expression (the time and cell type in which the gene productis produced) are thought to be a major factor in the evolution of different organisms. Would you expect thesame protein to work in the same way (for example, toperform the same kind of enzymatic reaction) in twodifferent types of cells (for example, cells in the retinaof the eye and muscle cells)? Is it possible that the sameprotein might function in different biochemical pathways in eye cells and muscle cells even if the protein’sbasic mechanism always remains the same?arrow_forward
- Microtubules in an animal cell: O a. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to vinblastine O b. undergo disassembly if the concentration of GDP-bound tubulin dimers is high and a cell is exposed to taxol O c. undergo disassembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicine O d. undergo assembly if the concentration of GTP-bound tubulin dimers is high and a cell is exposed to colchicinearrow_forwardDo question number 3 making inferencesarrow_forward. You receive four strains of yeast in the mail, and theaccompanying instructions state that each strain contains a single copy of transgene A. You grow the fourstrains and determine that only three strains expressthe protein product of transgene A. Further analysisreveals that transgene A is located at a different position in the yeast genome in each of the four strains.Provide a hypothesis to explain this resultarrow_forward
- GIVE REASON ALSOarrow_forward51. In conjugation, the F+ cell ................................ Group of answer choices serves as a recipient makes competence factors can transfer DNA to other F+ cells contains information for sex pili don't have conjugation pili 52. Bacterial cells when placed in an hypertonic environment ( more solute outside cells compared to inside ) Group of answer choices initiates sporulation process neither of the above happens undergo plasmolysis undergo osmotic lysis germination occursarrow_forwardin term of signal transduction how cell cycle/division is controlled?? ((while you are answerig plz write the refrence.))arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Endosymbiotic Theory; Author: Amoeba Sisters;https://www.youtube.com/watch?v=FGnS-Xk0ZqU;License: Standard Youtube License