Campbell Biology in Focus
3rd Edition
ISBN: 9780134710679
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Rebecca Orr
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15.3, Problem 1CC
WHAT IF? Suppose the mRNA being degraded in Figure 15.13 coded for a protein that promotes cell division in a multicellular organism. What would happen if a mutation disabled the gene for the miRNA that triggers this degradation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
asap please
A partially filled diagram of eukaryotic gene structure is shown below. Label the following additional elements in the empty boxes. One label must be used twice: a) 3'UTR, b) 5'UTR, c) exon, d) intron, e) promoter
Pls Provide what is being asked in the picture given
Q34. mRNA decay (breakdown) can play an important role in controlling protein abundance.
Which of the following scenarios correctly describes a relationship between mRNA decay and protein abundance?
A. A decrease in transcription with an increase in the rate of mRNA decay can result in increased protein abundance.
B. An increase in transcription with an increase in the rate of mRNA decay can result in no change in protein abundance.
C. An increase rate of protein synthesis but failure to form an apoprotein can be explained by a decrease in mRNA decay.
D. None of the above
Chapter 15 Solutions
Campbell Biology in Focus
Ch. 15.1 - How does binding of the trp corepressor to its...Ch. 15.1 - Describe the binding of RNA polymerase,...Ch. 15.1 - WHAT IF? A certain mutation in E. coli changes the...Ch. 15.2 - Prob. 1CCCh. 15.2 - Compare the roles of general and specific...Ch. 15.2 - Prob. 3CCCh. 15.3 - WHAT IF? Suppose the mRNA being degraded in Figure...Ch. 15.3 - MAKE CONNECTIONS Inactivation of one of the X...Ch. 15.4 - Prob. 1CCCh. 15.4 - WHAT IF? Study the microarray in Figure 15.17. If...
Ch. 15 - If a particular operon encodes enzymes for making...Ch. 15 - The functioning of enhancers is an example of A. a...Ch. 15 - Which of the following is an example of...Ch. 15 - Prob. 4TYUCh. 15 - Prob. 5TYUCh. 15 - Which of the following would not be true of cDNA...Ch. 15 - Prob. 7TYUCh. 15 - SCIENTIFIC INQUIRY Imagine you want to study one...Ch. 15 - FOCUS ON EVOLUTION DNA sequences can act as tape...Ch. 15 - FOCUS ON INTERACTIONS In a short essay (100150...Ch. 15 - Prob. 11TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes, 5th edition
Jellyfish Lake, located on the Pacific island of Palau, is home to millions of jellyfish. Many years ago, sea l...
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
Describe the evolution of mammals, tracing their synapsid lineage from early amniote ancestors to true mammals....
LooseLeaf for Integrated Principles of Zoology
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Plz asaparrow_forwardHey, I need help with this: Describe the main events that occur after transcription to generate a mature mRNA and ensure its correct localisation in the cell. Please include splicing, 5' and 3' modifications, RNA export from the nucleus, and how some mRNAs are localised within the cytoplasm. Please be very detailed and long explanation ,and dont copy from google answer in your own words asap pleasearrow_forwardQ10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forward
- Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.arrow_forwardE32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||arrow_forwardQ1: Why is only one strand of DNA used as a template? Q2: If a mutation occurred within the promoter or terminator region, do you think it would affect the mRNA transcribed? Why or why not? Q3: The template strand of part of a gene has the base sequence TGAGAAGACCAGGGTTGT. What is the sequence of RNA transcribed from this DNA, assuming that RNA polymerase travels from left to right on this strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY