ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 9P
An example of a gene-targeting DNA plasmid vector for insertion of a transgene into chloroplast DNA by biolistic transformation is shown in the following diagram. The plasmid DNA can be prepared in large quantities in E. coli before being shot into plant cells with a gene gun. Match the component of the construct with its function. (RE1, RE2, and RE3 are different restriction enzyme recognition sites unique to the plasmid vector.)
| a. spectinomycin | 1. DNA that mediates resistance gene integration |
| b. cpDNA sequences | 2. gene used to select chloroplast transformants |
| c. RE2 | 3. sequence for plasmid replication in E. coli |
| d. ori | 4. sites at which targeting chloroplast DNA can be inserted into the vector |
| e. RE1 and RE3 | 5. site at which transgene can be inserted into the vector |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.
You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The
plasmid is then used to transform E.coli colls Is the following statement True or False?
Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid.
Clal Hindlll
EcoRI
Pvul
BamHI
Pstl
amp
tet
PBR322
-Sall
ori
rop
Pvull
True
False
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker(such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
Chapter 15 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.arrow_forwardA shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEp), Yeast Integrating Plasmid (YIp) and Yeast Replicating Plasmid (YRp). Among these three vectors, YIp has the lowest transformation frequency and copy number per cell. Explain why Ylp is still popularly used despite its limitations.arrow_forwardIn bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forward
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardLiliana is preparing chemically competent cells for heat shock transformation from old batches of competent cells available in the freezers. The competent cells would eventually be used for the expression of a prokaryotic enzyme using the pET vector system. (1) (ii) Why is Escherichia coli DH5a suitable to propagate the plasmid before protein expression? During the protein expression step, the plasmids are transformed into a different host cell, BL21(DE3). Explain why this step is pertinent to express the protein of interest.arrow_forwardThe modifiedplasmid is reintroduced back into Rhizobium(step 4) and the genetically transformed bacteria are then selected based on the amp and lacZgenes present within the plasmid. The plasmid may or may not integrate the BBW resistancegene. The treated bacteria may or may not take up the modified plasmid. a) Complete the table below with a yes or no in each space stating whether you would expect these bacteria to grow or not. Type of treated bacteria culture plate(no amp) Culture plate treated with ampicillin Plasmid not taken up Plasmid taken up (WithoutBBW resistancegene) Plasmid taken up (WithBBW resistancegene) B) Outline how the genetically transformed bacteria containing the BBW resistance gene can beselected based on the amp and lacZgenes present within the plasmid.arrow_forward
- Which of the delivery techniques mentioned in Table 2 can be used to best transfer recombinant plasmids into E. coli cellsarrow_forwardA plasmid, pUC18, contains the ampicillin-resistance gene, the origin of replication, and the ß - gal gene, which codes for the B-galactosidase protein. This protein can break down the synthetic chemical X-gal, producing a blue product that stains the entire cell blue (but is harmless to the bacteria). At the beginning of the B-gal gene there are several unique restriction sites (some of them are shown in the diagram below). You wish to clone a 1.0-kb Xbal fragment into the pUC18 plasmid, so you cut the plasmid with Xbal and, after removing the enzyme, mix the Xbal-cut plasmid with the 1.0-kb fragment, ligate, and transform competent bacteria. Pati Xbal EcoRI B-gal A Amp ori Figure: pUC18 plasmid map (a) On what medium would you grow your transformed bacteria? (b) Do you expect the bacteria carrying plasmid pUC18 (without the insert) to be blue or white when grown in the presence of X-gal? Explain.arrow_forwardNow that you’ve isolated the gene and made lots of copies, you need to insert the gene into something you can manipulate and move into your lab strain of E. coli. You have access to the following vectors, either pBR322 or pUC19 (look them up here to see a map https://www.neb.com/products/dna-plasmids-and-substrates Please note the restriction sites in BOLD appear only once in the plasmid). You may use either vector. What is a vector? Which vector did you choose? Explain why you made that choice. What enzyme(s) will you use to place your fragment into the vector? Explain why you chose these enzymes. How will you move this construct into coli? What phenotype will tell you if the coli have taken up the plasmid? What phenotype will tell you if the coli have taken up the plasmid with the gasP gene?arrow_forward
- In relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).arrow_forwardA biologist is attempting to clone the gene encoding a particular enzyme (Enz) into a plasmid vector in E.coli. This plasmid has a gene encoding a green fluorescent protein (GFP) as well as a gene for tetracycline antibiotic resistance (TetR). The restriction site (to clone foreign DNA into) is within the GFP sequence. Which of the following would be expected when trying to see which E. coli cells acquired the recombinant plasmid (i.e., carrying the Enz gene)? Bacteria UNABLE to grow on tetracycline-containing media AND are NOT able to make green fluorescent protein are the ones that contain the recombinant plasmid. Bacteria able to grow on tetracycline-containing media AND that are NOT able to make green fluorescent protein are the ones that contain the recombinant plasmid. Bacteria able to grow on tetracycline-containing media AND are able to make green fluorescent protein are the ones that contain the recombinant plasmid. Bacteria UNABLE to…arrow_forwardIn the genotype presented (genomic plus plasmid genes), which of the following statements Is phenotype? genome: IS P O`z+Y° plasmid: I* Pt otzY+ no production of either B-gal and permease O B-gal and permease induced when lactose is present no B-gal is produced and expression of permease when lactose is present constitutive expression of B-gal and permease constitutive expression of B-gal and no expression of permeasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License