ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
6th Edition
ISBN: 9781260406092
Author: HARTWELL, Leland, HOOD, Leroy, Goldberg, Michael
Publisher: Mcgraw-hill Education/stony Brook University
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 2P
Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNA isolated from human tissue would be mtDNA?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If we are given this segment of DNA:
TTGGHTGUTGG
HHUUTHUGHUU
Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated two times? (note Hypoxanthine pairs with cytosine) and so there would be four sets?
DNA is isolated from concentrated ocean water. One genome is studied, and the proportion of each nucleotide is A = 15%, C = 35%, G = 35% and T = 15%. Is this genome from a dsDNA or ssDNA organism? Explain your reasoning. Is this organism AT-rich or GC-rich?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below.
pGGCGACCGATTAGTCCCATCGATGGG−OH
Chapter 15 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
Ch. 15 - Match each numbered item with the most closely...Ch. 15 - Assuming human cells have on average 1000...Ch. 15 - Reverse translation is a term given to the process...Ch. 15 - The human nuclear genome encodes tRNAs with 32...Ch. 15 - The human mitochondrial genome includes no genes...Ch. 15 - How do you know if the halibut you purchased at...Ch. 15 - Is each of these statements true of chloroplast or...Ch. 15 - Suppose you are characterizing the DNA of a...Ch. 15 - An example of a gene-targeting DNA plasmid vector...Ch. 15 - Which of the following characteristics of...
Ch. 15 - The Saccharomyces cerevisiae nuclear gene ARG8...Ch. 15 - The so-called hypervariable regions HV1 and HV2 of...Ch. 15 - Suppose a new mutation arises in a mitochondrial...Ch. 15 - Describe at least two ways in which the...Ch. 15 - Why are severe mitochondrial or chloroplast gene...Ch. 15 - Suppose you are examining a newly found plant...Ch. 15 - A form of male sterility in corn is inherited...Ch. 15 - Plant breeders have long appreciated the...Ch. 15 - A mutant haploid strain of Saccharomyces...Ch. 15 - Prob. 20PCh. 15 - What characteristics in a human pedigree suggest a...Ch. 15 - The first person in the family represented by the...Ch. 15 - In 1988, neurologists in Australia reported the...Ch. 15 - If you were a genetic counselor and had a patient...Ch. 15 - Kearns-Sayre syndrome KSS, Pearson syndrome, and...Ch. 15 - Many clinically relevant mitochondrial diseases...Ch. 15 - Leigh syndrome is characterized by psychomotor...Ch. 15 - All mutations in mitochondrial genes ultimately...Ch. 15 - How could researchers have determined that the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- An analysis is performed to determine the proportions of each of the four nucleotide bases in the DNA of several tissue samples from various species. The results appear in the table. Human Chicken Yeast E. coli % Adenine % Guanine (A) (G) 31 20 28 21 32 18 26 25 % Thymine % Cytosine (T) 30 29 33 24 Which conclusions can be drawn from this data? (C) 19 22 17 25 The proportion of G is roughly equal to the proportion of C. The proportion of A is roughly equal to the proportion of T. The proportion of pyrimidines is roughly equal to the proportion of purines. The proportion of A-T base pairs is roughly equal to the proportion of G-C base pairs.arrow_forwardCan you please help with this question?arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forward
- Below is an image of the results of a gel electrophoresis experiment. Lanes 1-4 contain amplified DNA fragments and Lane 5 contains the DNA size marker (DSM). From this image and by only using Lanes 1- 4 which lane matches each description below? a) This lane contains the largest DNA fragment: b) This lane contains the smallest DNA fragment: c) This lane contains a 2.5 kbp DNA fragment: 42 | || ||| | || 12 kb 9.5 kb 6.5 kb 4 kb 2 kb ***arrow_forwardA DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing nucleotides. How many pyrimidine bases does this DNA segment possess?arrow_forwardMuch of the human genome consists of repetitious DNA. Describe the difference between microsatellite and minisatel lite DNA. How is this repetitious DNA useful for identifying individuals by the technique of DNA fingerprinting?arrow_forward
- What is DNA? Provide a 5-sentence long description only.arrow_forwardPeople who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence.People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gelarrow_forwardUsing a laser beam, you isolated several R bands from human chromosomes. Answer the following questions What kinds of genes are present in R bands? Which isochors do you expect to be present in the R band? What class of interspersed repeats will be present in R bands? What class of tandem repeats do you expect to find in RG bands? Would you expect to find telomere sequences in some R bands?arrow_forward
- People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individuals and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel.arrow_forwardScientists identify a tumor cell in rats that divides more rapidly in the presence of galactose. When they sequence the DNA of the tumor cells, they identify retroviral DNA. Explain what circumstances might have occurred that produced this phenotype.arrow_forwardSuppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw a diagram of the expected gel to show the location of the cut DNA pieces. arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY