
Human Anatomy & Physiology Plus Mastering A&P with Pearson eText -- Access Card Package (2nd Edition) (What's New in Anatomy & Physiology)
2nd Edition
ISBN: 9780134702339
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 4AYKA
Summary Introduction
To review:
The effect on hearing when the round window of the ear becomes very stiff.
Introduction:
Ear is considered to be the primary organthat participates in the process of hearing. This organ is known to be segregated into three parts, namely outer, middle, and inner. Each part comprises different structures that are responsible for performing a different independent function in the process of hearing.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 15 Solutions
Human Anatomy & Physiology Plus Mastering A&P with Pearson eText -- Access Card Package (2nd Edition) (What's New in Anatomy & Physiology)
Ch. 15.1 - What are the three major differences between the...Ch. 15.1 - What is sensory transduction?Ch. 15.2 - 1. Where is the olfactory epithelium located?
Ch. 15.2 - 2. What types of cells make up the olfactory...Ch. 15.2 - Describe the structure of an olfactory neuron.Ch. 15.2 - What happens in an olfactory neuron when an...Ch. 15.2 - How can humans detect such a variety of odors with...Ch. 15.2 - Prob. 6QCCh. 15.3 - Where are taste buds located?Ch. 15.3 - Prob. 2QC
Ch. 15.3 - Prob. 3QCCh. 15.3 - Prob. 4QCCh. 15.3 - How does a gustatory cell transduce a chemical...Ch. 15.3 - 6. Which cranial nerves transmit taste sensation...Ch. 15.3 - 7. Which part of the brain is responsible for...Ch. 15.4 - What are the functions of the tarsal glands and...Ch. 15.4 - Trace the path of tears as they travel from the...Ch. 15.4 - 3. Which two extrinsic eye muscles move the eye...Ch. 15.4 - Prob. 4QCCh. 15.4 - 5. What are the functions of each component of...Ch. 15.4 - 6. What are the two fluids found in the eyeball?...Ch. 15.5 - Prob. 1QCCh. 15.5 - Prob. 2QCCh. 15.5 - What is accommodation?Ch. 15.5 - Prob. 4QCCh. 15.5 - 5. What is the near point of accommodation, and...Ch. 15.5 - 6. How do myopia and hyperopia differ?
Ch. 15.5 - How are rods different from cones?Ch. 15.5 - Why are photoreceptors depolarized in the dark?Ch. 15.5 - How do rods hyperpolarize when light strikes them?...Ch. 15.5 - 10. What happens at the optic chiasma? What is...Ch. 15.5 - 11. What type of visual processing occurs in the...Ch. 15.6 - 1. What is the auricle?
Ch. 15.6 - What is the purpose of cerumen?Ch. 15.6 - 3. Where is the tympanic membrane located?
Ch. 15.6 - Prob. 4QCCh. 15.6 - What is the role of the pharyngotympanic tube?Ch. 15.6 - What are the functions of the utricle, saccule,...Ch. 15.6 - How are the scala tympani, scala media, and scala...Ch. 15.6 - 8. What is the spiral organ, and where is it...Ch. 15.7 - 1. What physical properties determine the pitch...Ch. 15.7 - 2. What is the range (in hertz) of human...Ch. 15.7 - 3. Why is the force exerted on the oval window...Ch. 15.7 - Prob. 4QCCh. 15.7 - Prob. 5QCCh. 15.7 - Prob. 6QCCh. 15.7 - Prob. 7QCCh. 15.7 - Prob. 8QCCh. 15.8 - How do static and dynamic equilibrium differ?Ch. 15.8 - 2. What role do the utricle and saccule play in...Ch. 15.8 - What role do they play in dynamic equilibrium?Ch. 15.8 - Prob. 4QCCh. 15.8 - 5. What are the three primary areas of the...Ch. 15 - Match the cell type with the correct stimulus....Ch. 15 - 2. The axons of the olfactory nerve terminate in...Ch. 15 - 3. Fill in the blanks: In an olfactory neuron, the...Ch. 15 - The primary olfactory cortex is located in the: a....Ch. 15 - 5. Which of the following statements is true...Ch. 15 - Match the taste with the chemical substance that...Ch. 15 - Prob. 7CYRCh. 15 - Prob. 8CYRCh. 15 - 9. Which cells in the retina are depolarized in...Ch. 15 - Prob. 10CYRCh. 15 - Each of the following statements is false. Correct...Ch. 15 - The axons from the nasal retina in the left eye...Ch. 15 - Mark the following statements as true or false. If...Ch. 15 - Explain how sounds of different frequencies are...Ch. 15 - Prob. 15CYRCh. 15 - Prob. 16CYRCh. 15 - Prob. 17CYRCh. 15 - 18. True or false: Hair cells in the spiral organ...Ch. 15 - 19. Which of the following is not part of the...Ch. 15 - 20. Fill in the blanks: In the ampulla of a...Ch. 15 - Stimuli from the inner ear regarding head movement...Ch. 15 - 1. Explain what would happen to your sense of...Ch. 15 - In which direction would you be unable to move...Ch. 15 - If a patient suffers visual impairment only in one...Ch. 15 - 4. Following a stroke, a patient lost vision in...Ch. 15 - Why do you have the sensation that you are still...Ch. 15 - 1. Mr. Spencer suffers loss of taste sensation....Ch. 15 - 2. Your friend tells you that she has just been...Ch. 15 - Prob. 3AYKACh. 15 - Prob. 4AYKACh. 15 - Mrs. Flores is a 45-year-old female who suffered a...Ch. 15 - 6. Your 60-year-old patient, Mr. Guster, has...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License