ANATOMY+PHYSIOLOGY LAB MANUAL >CUSTOM<
4th Edition
ISBN: 9781266303067
Author: McKinley
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 14.4, Problem 13WDYL
Summary Introduction
To explain:
The difference between the direct and indirect motor pathways.
Concept introduction:
The direct pathway involves the transfer of the signal impulse in the brain through the formation of the synapses and junctions between the neurons. The signal is finally transferred to the spinal cord. The indirect pathway involves the transfer of the signal impulses from the brain to the spinal cord.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 14 Solutions
ANATOMY+PHYSIOLOGY LAB MANUAL >CUSTOM<
Ch. 14.1 - Prob. 1WDYLCh. 14.1 - Prob. 2WDYLCh. 14.1 - Prob. 3WDYLCh. 14.1 - Prob. 4WDYLCh. 14.2 - Prob. 5WDYLCh. 14.3 - Prob. 6WDYLCh. 14.3 - Prob. 7WDYLCh. 14.3 - Prob. 8WDYLCh. 14.4 - Prob. 9WDYLCh. 14.4 - Prob. 10WDYL
Ch. 14.4 - Prob. 11WDYLCh. 14.4 - Prob. 12WDYLCh. 14.4 - Prob. 13WDYLCh. 14.5 - Prob. 14WDYLCh. 14.5 - Prob. 15WDYLCh. 14.5 - Prob. 16WDYLCh. 14.5 - Prob. 17WDYLCh. 14.5 - Prob. 18WDYLCh. 14.5 - Prob. 19WDYLCh. 14.5 - Which nerve might you have damaged if you have...Ch. 14.5 - Prob. 21WDYLCh. 14.5 - Prob. 22WDYLCh. 14.5 - Prob. 23WDYLCh. 14.6 - What are the four main properties of a reflex?Ch. 14.6 - Prob. 25WDYLCh. 14.6 - Prob. 26WDYLCh. 14.6 - What is the major difference between monosynaptic...Ch. 14.6 - Prob. 28WDYLCh. 14.6 - Identify the Golgi tendon reflex (which is an...Ch. 14.6 - Prob. 30WDYLCh. 14.7 - Prob. 31WDYLCh. 14 - Prob. 1DYKBCh. 14 - Prob. 2DYKBCh. 14 - Prob. 3DYKBCh. 14 - Prob. 4DYKBCh. 14 - Prob. 5DYKBCh. 14 - Prob. 6DYKBCh. 14 - Prob. 7DYKBCh. 14 - Prob. 8DYKBCh. 14 - Prob. 9DYKBCh. 14 - Prob. 10DYKBCh. 14 - Prob. 11DYKBCh. 14 - List the three gray matter horns on each side of...Ch. 14 - Compare the main differences between the posterior...Ch. 14 - Prob. 14DYKBCh. 14 - Prob. 15DYKBCh. 14 - Prob. 16DYKBCh. 14 - Prob. 17DYKBCh. 14 - Prob. 18DYKBCh. 14 - Prob. 19DYKBCh. 14 - Prob. 20DYKBCh. 14 - Prob. 1CALCh. 14 - Prob. 2CALCh. 14 - Prob. 3CALCh. 14 - Prob. 4CALCh. 14 - Prob. 5CALCh. 14 - Prob. 1CSLCh. 14 - Prob. 2CSLCh. 14 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license