Concept explainers
To determine: The method of development of a transgenic mouse model with a particular neurodegenerative disease.
Introduction: A model organism is an organism which has about 90% genes identical to the humans and on which the studies of human diseases can be conducted. A model organism should be small and have short generation time so that biological studies can be conducted on them conveniently. Drosophila melanogaster and Mus musculus are certain examples of model organisms used to study human diseases.
To determine: The use of model organism to study the disease or look for new treatments.
Introduction: A model organism is an organism which has about 90% genes identical to the humans and on which the studies of human diseases can be conducted. A model organism should be small and have short generation time so that biological studies can be conducted on them conveniently. Drosophila melanogaster and Mus musculus are certain examples of model organisms used to study human diseases.
Want to see the full answer?
Check out a sample textbook solutionChapter 14 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
- What are the advantages of human genome project?arrow_forwardOne concern about using genetically-modified organisms is that many of the methods used to create them introduce into the genome DNA from a different species (i.e. foreign DNA). Which of the following methods has the lowest potential of introducing foreign DNA into the genome?A. A gene knockout in mouse using homologous recombination in ES cellsB. Introduction of a P element vector into the Drosophila germ-lineC. Deletion mutations introduced by CRISPR/Cas9D. Microinjection of a transgene into a mouse pronucleusarrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- To clone a bacterial lipase gene into the cloning vector pET28a, you know the full sequence of the gene to be cloned. While you are designing the experiments, which bioinformatics tool(s) you want to use? Suggest a roadmap for this studyarrow_forwardBecause genetic engineering involves the modification of an organism's set of instructions, it has created a dilemma raising both moral and ethical concerns. For instance, a biotechnological company has found a way to produce rice that is immune to pests and diseases, which is vital for the establishment of food security. However, the methods that will be implemented are by splicing off the genes of endangered pandas using invasive procedures that may harm their population. Will you support this? Why or why not? Limit your answers to 5 sentences or less. Be brief and concise.arrow_forwardGenetic engineering has been used in many different ways, such as human growth hormone for the treatment of pituitary dwarfism (recombinant DNA) plants engineered to be resistant to herbicides and pests an “antifreeze” gene inserted into some Atlantic salmon and halibut pick one of the examples of genetic engineering listed above to expand on. Provide a description of the technology in terms of how it works and what steps are takenarrow_forward
- Suppose that you have just graduated from college and have started working at a biotechnology firm. Your first job assignment is to clone the pig gene for the hormone prolactin. Assume that the pig gene for prolactin has not yet been isolated, sequenced, or mapped; however, the mouse gene for prolactin has been cloned, and the amino acid sequence of mouse prolactin is known. Briefly explain two different strategies that you might use to find and clone the pig gene for prolactin.arrow_forwardWhat is the difference between manipulating a gene for gene therapy and for producing a transgenic organism?arrow_forwardBriefly describe the creation of a transgenic mouse in your lab.arrow_forward
- Biotechnology is a constantly developing field with many exciting applications. It focuses on the use of living organisms and their biological processes to make useful products and address practical problems. This includes advancements in clinical diagnostics, epidemiological tracking, forensics, industry, and many other areas. In this simulation, you will have the opportunity to perform molecular techniques commonly used in the field of biotechnology to create medically important compounds such as insulin and human growth hormone.Bacteria can obtain naked DNA from their environment in a process called transformation. This process occurs naturally but can also be used in the genetic engineering field to alter the genetic makeup of bacteria. In this simulation, you transform bacteria with a jellyfish gene whose product is green fluorescent protein. The transformed bacteria now have the genetic information to produce GFP (green fluorescent protein), causing them to glow green under…arrow_forwardExplain the use of transgenic animals to model gain-of-function genetic diseases in humans.arrow_forwardAshanti Silva received the first gene therapy for the treatment of SCID. What do you think, would the combination of gene therapy and stem cell therapy be a better therapeutic option?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning