
Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13.4, Problem 11LO
Summary Introduction
To describe: A polysome in bacterial cells.
Introduction: Translation, also called as decoding process, is the process of synthesis of proteins or polypeptide chains. The information from mRNA is used to build up a protein. In the ribosome, the mRNA is decoded to produce a specific chain of amino acid.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 13 Solutions
Biology (MindTap Course List)
Ch. 13.1 - Summarize the early evidence indicating that some...Ch. 13.1 - Describe how Beadle and Tatums experiments...Ch. 13.1 - Prob. 1CCh. 13.1 - How did the work of each of the following...Ch. 13.2 - Outline the flow of genetic information in cells,...Ch. 13.2 - Compare the structures of DNA and RNA.Ch. 13.2 - Explain why the genetic code is said to be...Ch. 13.2 - VISUALIZE Sketch a simple flow diagram that shows...Ch. 13.2 - Prob. 2CCh. 13.3 - Compare the processes of transcription and DNA...
Ch. 13.3 - Compare bacterial and eukaryotic mRNAs, and...Ch. 13.3 - In what ways are DNA polymerase and RNA polymerase...Ch. 13.3 - A certain template DNA strand has the following...Ch. 13.3 - What features do mature eukaryotic mRNA molecules...Ch. 13.4 - Identify the features of tRNA that are important...Ch. 13.4 - Explain how ribosomes function in polypeptide...Ch. 13.4 - Prob. 10LOCh. 13.4 - Prob. 11LOCh. 13.4 - What are ribosomes made of? Do ribosomes carry...Ch. 13.4 - What happens in each stage of polypeptide...Ch. 13.4 - A certain mRNA strand has the following nucleotide...Ch. 13.5 - Give examples of the different classes of...Ch. 13.5 - What are the main types of mutations?Ch. 13.5 - Prob. 2CCh. 13.6 - Briefly discuss RNA interference.Ch. 13.6 - Prob. 14LOCh. 13.6 - Prob. 15LOCh. 13.6 - Prob. 1CCh. 13.6 - Prob. 2CCh. 13.6 - Prob. 3CCh. 13 - Prob. 1TYUCh. 13 - What is the correct order of information flow in...Ch. 13 - During transcription, how many RNA nucleotide...Ch. 13 - The genetic code is defined as a series of...Ch. 13 - RNA differs from DNA in that the base...Ch. 13 - Prob. 6TYUCh. 13 - Which of the following is/are not found in a...Ch. 13 - Which of the following is/are typically removed...Ch. 13 - Prob. 9TYUCh. 13 - Suppose you mix the following components of...Ch. 13 - Prob. 11TYUCh. 13 - Prob. 12TYUCh. 13 - Compare and contrast the formation of mRNA in...Ch. 13 - Explain to a friend the experimental strategy that...Ch. 13 - Biologists hypothesize that transposons eventually...Ch. 13 - Prob. 16TYUCh. 13 - Prob. 17TYUCh. 13 - Prob. 18TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Bacterial Structure and Functions; Author: Osmosis;https://www.youtube.com/watch?v=b15Hy3jCPDs;License: Standard youtube license