Biology (MindTap Course List)
Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
bartleby

Concept explainers

Question
Book Icon
Chapter 13, Problem 1TYU
Summary Introduction

Introduction: A gene is a set of nucleotides that code for a particular protein. Gene expression causes the synthesis of a protein. The gene expression is regulated in controlled way depending on the requirement of the cell. For example, proteins involved in cell division are synthesized prior to the cell division. Prokaryotic and eukaryotic genes have differential gene expression in order to suit the specific needs of the cell.

Expert Solution & Answer
Check Mark

Answer to Problem 1TYU

Correct answer: Beadle and Tatum studied the relationship between genes and enzymes in Neurospora. Hence, the correct answer is option (e).

Explanation of Solution

Reason for the correct answer.

Option (e) is given as “studied the relationship between genes and enzymes in Neurospora”.

Beadle and Tatum took thousands of haploid wild-type Neurospora and exposed their spores to X-rays or ultraviolet radiation to produce mutant strains. Then, the mutant strain is tested and identified that the actual enzymatic step is blocked due to the mutant gene that prevents the production of chemical which is essential for growth. The experiment of Neurospora exposed that each mutant strain had a particular mutation in only one gene and the gene mainly affects one enzyme-catalyzed chemical reaction. Beadle and Tatum proposed one gene-one enzyme hypothesis and this explains the one-to-one correspondence between genes and enzymes.

Hence, the correct answer is option (e).

Reasons for incorrect answers.

Option (a) is given as, “predicted that tRNA molecules would have anticodons”. At the time of Beadle and Tatum experiment, the hypothesis about tRNA is not given. Hence, option (a) is incorrect.

Option (b) is given as, “discovered the genetic disease alkaptonuria”. Physician and biochemist Archibald Garrod discovered the genetic disease alkaptonuria. Hence, option (b) is incorrect.

Option (c) is given as, “showed that the genetic disease sickle cell anemia is caused by a change in a single amino acid in a hemoglobin polypeptide chain”. Linus Pauling, a chemist in United States (U.S.) showed that the genetic disease sickle cell anemia is caused by a change in a single amino acid in a hemoglobin polypeptide chain. Hence, option (c) is incorrect.

Option (d) is given as, “worked out the genetic code”. Beadle and Tatum is not associated with the experiment of genetic coding. Hence, option (d) is incorrect.

Hence, the options (a), (b), (c), and (d) are incorrect.

Conclusion

In the early 1940s, a new approach is developed about understanding the relationship between genes and enzymes in Neurospora by the experiment of U.S. geneticists George Beadle, Edward Tatum, and their associates.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 13 Solutions

Biology (MindTap Course List)

Ch. 13.3 - Compare bacterial and eukaryotic mRNAs, and...Ch. 13.3 - In what ways are DNA polymerase and RNA polymerase...Ch. 13.3 - A certain template DNA strand has the following...Ch. 13.3 - What features do mature eukaryotic mRNA molecules...Ch. 13.4 - Identify the features of tRNA that are important...Ch. 13.4 - Explain how ribosomes function in polypeptide...Ch. 13.4 - Prob. 10LOCh. 13.4 - Prob. 11LOCh. 13.4 - What are ribosomes made of? Do ribosomes carry...Ch. 13.4 - What happens in each stage of polypeptide...Ch. 13.4 - A certain mRNA strand has the following nucleotide...Ch. 13.5 - Give examples of the different classes of...Ch. 13.5 - What are the main types of mutations?Ch. 13.5 - Prob. 2CCh. 13.6 - Briefly discuss RNA interference.Ch. 13.6 - Prob. 14LOCh. 13.6 - Prob. 15LOCh. 13.6 - Prob. 1CCh. 13.6 - Prob. 2CCh. 13.6 - Prob. 3CCh. 13 - Prob. 1TYUCh. 13 - What is the correct order of information flow in...Ch. 13 - During transcription, how many RNA nucleotide...Ch. 13 - The genetic code is defined as a series of...Ch. 13 - RNA differs from DNA in that the base...Ch. 13 - Prob. 6TYUCh. 13 - Which of the following is/are not found in a...Ch. 13 - Which of the following is/are typically removed...Ch. 13 - Prob. 9TYUCh. 13 - Suppose you mix the following components of...Ch. 13 - Prob. 11TYUCh. 13 - Prob. 12TYUCh. 13 - Compare and contrast the formation of mRNA in...Ch. 13 - Explain to a friend the experimental strategy that...Ch. 13 - Biologists hypothesize that transposons eventually...Ch. 13 - Prob. 16TYUCh. 13 - Prob. 17TYUCh. 13 - Prob. 18TYU
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning