
Concept explainers
Introduction: A gene is a set of

Answer to Problem 1TYU
Correct answer: Beadle and Tatum studied the relationship between genes and enzymes in Neurospora. Hence, the correct answer is option (e).
Explanation of Solution
Reason for the correct answer.
Option (e) is given as “studied the relationship between genes and enzymes in Neurospora”.
Beadle and Tatum took thousands of haploid wild-type Neurospora and exposed their spores to X-rays or ultraviolet radiation to produce mutant strains. Then, the mutant strain is tested and identified that the actual enzymatic step is blocked due to the mutant gene that prevents the production of chemical which is essential for growth. The experiment of Neurospora exposed that each mutant strain had a particular mutation in only one gene and the gene mainly affects one enzyme-catalyzed
Hence, the correct answer is option (e).
Reasons for incorrect answers.
Option (a) is given as, “predicted that tRNA molecules would have anticodons”. At the time of Beadle and Tatum experiment, the hypothesis about tRNA is not given. Hence, option (a) is incorrect.
Option (b) is given as, “discovered the genetic disease alkaptonuria”. Physician and biochemist Archibald Garrod discovered the genetic disease alkaptonuria. Hence, option (b) is incorrect.
Option (c) is given as, “showed that the genetic disease sickle cell anemia is caused by a change in a single amino acid in a hemoglobin polypeptide chain”. Linus Pauling, a chemist in United States (U.S.) showed that the genetic disease sickle cell anemia is caused by a change in a single amino acid in a hemoglobin polypeptide chain. Hence, option (c) is incorrect.
Option (d) is given as, “worked out the genetic code”. Beadle and Tatum is not associated with the experiment of genetic coding. Hence, option (d) is incorrect.
Hence, the options (a), (b), (c), and (d) are incorrect.
In the early 1940s, a new approach is developed about understanding the relationship between genes and enzymes in Neurospora by the experiment of U.S. geneticists George Beadle, Edward Tatum, and their associates.
Want to see more full solutions like this?
Chapter 13 Solutions
Biology (MindTap Course List)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





