Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13.1, Problem 1CC
Given a polynucleotide sequence such as GAATTC, explain what further information you would need in order to identify which end is the 5′ end. (See Figure 13.6.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are the sequences of all the possible tripeptides that contain the amino acids aspartic acid, leucine, and phenylalanine? Use the threeletter abbreviations to express your answer.
We have talked about several examples of cis-acting elements that have dyad symmetry (inverted
repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give
one example of one that functions at the DNA level and briefly explain why the sequence requires
dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of
the element.
Edit View Incort Format Tools
Tablo
Write the complementary sequence for the following DNA sequence, in order from 3' to 5':
5′−CGATATTGAGCTAAGCTT−3′
Chapter 13 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - What is the basis for the difference in how the...Ch. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 12TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Describe Mendels conclusions about how traits are passed from generation to generation.
Concepts of Genetics (11th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (5th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Why is it unlikely that two neighboring water molecules would be arranged like this?
Campbell Biology (10th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forwardGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardWhat useful information might you get if you did determine the Nterminal amino acid as a separate step?arrow_forward
- Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'arrow_forwardWhat are the sequences of all the possible tripeptides that contain the amino acids, serine, leucine and phenylalanine? Use 3-letter abbreviations to express your answer.arrow_forwardWhat are the sequences of all the possibletripeptides that contain the amino acids aspartic acid, leucine, andphenylalanine? Use the three-letter abbreviations to express youranswer.arrow_forward
- Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGarrow_forwardFor the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardUsing the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) Barrow_forward
- Draw the complete structure of uridine 5′-phosphate, one of the four major ribonucleotides.arrow_forwardAlthough techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.arrow_forwardDesign a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtgaarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY