EBK HUMAN ANATOMY & PHYSIOLOGY
16th Edition
ISBN: 8220100659836
Author: AMERMAN
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 12.7, Problem 5QC
Summary Introduction
To review:
The definition and the functions of sleep.
Introduction:
All humans and animals are motile organisms. They perform multiple activities throughout the day. A lot of energy is spent in this process and the body becomes tired. The energy of the body is generated by the process of respiration, but the energy generated has to be conserved. The conservation of energy is done by sleep.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 12 Solutions
EBK HUMAN ANATOMY & PHYSIOLOGY
Ch. 12.1 - What types of functions are performed by the CNS?Ch. 12.1 - Prob. 2QCCh. 12.1 - Prob. 3QCCh. 12.1 - 4. What is the neural tube?
Ch. 12.1 - Prob. 5QCCh. 12.2 - Prob. 1QCCh. 12.2 - Prob. 2QCCh. 12.2 - Which component of the diencephalon performs each...Ch. 12.2 - Describe the basic anatomical arrangement of the...Ch. 12.2 - What is the primary function of the cerebellum?
Ch. 12.2 - Prob. 6QCCh. 12.2 - Prob. 7QCCh. 12.2 - What are the general functions of the reticular...Ch. 12.3 - 1. What are the three meninges, from superficial...Ch. 12.3 - 2. What are the three spaces (potential and...Ch. 12.3 - Prob. 3QCCh. 12.3 - Prob. 4QCCh. 12.3 - 5. What two factors create the blood brain...Ch. 12.3 - Prob. 6QCCh. 12.4 - Prob. 1QCCh. 12.4 - List and describe the three spinal meninges.Ch. 12.4 - Prob. 3QCCh. 12.4 - Prob. 4QCCh. 12.4 - What is the cauda equina?Ch. 12.4 - Prob. 6QCCh. 12.4 - Prob. 7QCCh. 12.4 - Prob. 8QCCh. 12.5 - 1. Where are the posterior columns and their two...Ch. 12.5 - Prob. 2QCCh. 12.5 - How are touch and pain processed by the cerebral...Ch. 12.5 - 4. How is the processing of olfactory stimuli...Ch. 12.6 - What is the main difference between the...Ch. 12.6 - Where do the fibers of the corticospinal tracts...Ch. 12.6 - Where do upper motor neurons reside, and what are...Ch. 12.6 - What are the two parts of the basal nuclei...Ch. 12.6 - What is the overall function of the cerebellum?Ch. 12.6 - Trace the overall voluntary movement pathway from...Ch. 12.7 - Which two body systems coordinate the maintenance...Ch. 12.7 - Which branch of the PNS controls most of the bodys...Ch. 12.7 - Prob. 3QCCh. 12.7 - Prob. 4QCCh. 12.7 - Prob. 5QCCh. 12.7 - What type of rhythm does human sleep follow?...Ch. 12.7 - 7. What is an electroencephalogram? What is the...Ch. 12.8 - 1. What is cognition? Which part of the brain is...Ch. 12.8 - What is cerebral lateralization? Which functions...Ch. 12.8 - 3. Define language in the context of neurology....Ch. 12.8 - Explain the differences between declarative memory...Ch. 12.8 - 5. How do immediate, short-term, and long-term...Ch. 12.8 - Prob. 6QCCh. 12 - The central nervous system is responsible for: a....Ch. 12 - Mark the following statements about the brain as...Ch. 12 - Prob. 3CYRCh. 12 - 4. Which statement about cerebral white matter is...Ch. 12 - Mark the following statements about the cerebral...Ch. 12 - Prob. 6CYRCh. 12 - 7. Match the term on the left with its correct...Ch. 12 - Which statement about the cranial meninges is...Ch. 12 - Prob. 9CYRCh. 12 - Prob. 10CYRCh. 12 - Mark the following statements about the spinal...Ch. 12 - Which of the following somatic sensations is not...Ch. 12 - Fill in the blanks: The tracts of the posterior...Ch. 12 - Which parts of the body have the greatest amount...Ch. 12 - Which of the following statements is false? a. The...Ch. 12 - Fill in the blanks: The cell bodies of upper motor...Ch. 12 - Label the following components of the...Ch. 12 - Mark the following statements on the role of the...Ch. 12 - 19. Fill in the blanks: The two components of the...Ch. 12 - 20. Which of the following statements is false?
a....Ch. 12 - 21. Match the term on the left with its correct...Ch. 12 - 22. The part of the brain responsible for the...Ch. 12 - Fill in the blanks: Declarative memories are...Ch. 12 - Prob. 24CYRCh. 12 - Huntingtons disease is characterized by a loss of...Ch. 12 - How could you tell the difference between an...Ch. 12 - Why do injuries to the hippocampus interfere with...Ch. 12 - Ms. Norris is brought to the emergency department...Ch. 12 - Prob. 2AYKCh. 12 - Prob. 3AYKCh. 12 - A new diet wonder drug is designed to block the...Ch. 12 - Prob. 5AYK
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Cardiopulmonary Anatomy & PhysiologyBiologyISBN:9781337794909Author:Des Jardins, Terry.Publisher:Cengage Learning,
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Cardiopulmonary Anatomy & Physiology
Biology
ISBN:9781337794909
Author:Des Jardins, Terry.
Publisher:Cengage Learning,
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning