The reason why during DNA replication , DNA polymerase do not move away from the replication fork on both strands. Introduction: DNA replication produces exact copies of a DNA from the original DNA molecule. DNA polymerase is responsible for addition of nucleotides in the growing chain. The replication involves three steps; initiation, elongation, and termination.

Question

Want to see the full answer?

Answer 1

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 12.5, Problem 1TC

Summary Introduction

To determine:

The reason why during DNA replication, DNA polymerase do not move away from the replication fork on both strands.

Introduction:

DNA replication produces exact copies of a DNA from the original DNA molecule. DNA polymerase is responsible for addition of nucleotides in the growing chain. The replication involves three steps; initiation, elongation, and termination.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

Answer 2

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 12.5, Problem 1TC

Summary Introduction

To determine:

The reason why during DNA replication, DNA polymerase do not move away from the replication fork on both strands.

Introduction:

DNA replication produces exact copies of a DNA from the original DNA molecule. DNA polymerase is responsible for addition of nucleotides in the growing chain. The replication involves three steps; initiation, elongation, and termination.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 12.5, Problem 1TC

Summary Introduction

To determine:

The reason why during DNA replication, DNA polymerase do not move away from the replication fork on both strands.

Introduction:

DNA replication produces exact copies of a DNA from the original DNA molecule. DNA polymerase is responsible for addition of nucleotides in the growing chain. The replication involves three steps; initiation, elongation, and termination.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 12.5, Problem 1TC

Summary Introduction