Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
9th Edition
ISBN: 9780135168035
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 1RQ
Summary Introduction
To determine:
The components of the peripheral nervous system.
Introduction:
Nervous system is responsible for sensing the stimulus, integration of the sensory input, and triggering output response. It is classified into two anatomical sub-parts: central nervous system (CNS) and peripheral nervous system (PNS). The peripheral nervous system is responsible for connecting the brain and the spinal cord with the rest of the body.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 12 Solutions
Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
Ch. 12 - In which direction are afferent signals carried?...Ch. 12 - What subdivision of the nervous system regulates...Ch. 12 - What type of sensation is (a) pain from a pulled...Ch. 12 - Which type of neuron process receives stimuli?Ch. 12 - Describe how the electrical impulse from one...Ch. 12 - What is the structural type of most sensory...Ch. 12 - Which structural type of neuron is most abundant?...Ch. 12 - Which neuroglia make myelin in the CNS? In the...Ch. 12 - Which neuroglia are common in regions where...Ch. 12 - Do Schwann cells cover nonmyelinated axons in the...
Ch. 12 - Name the connective tissue wrapping that encloses...Ch. 12 - Where do synaspes occur in the CNS, in white...Ch. 12 - Why is white matter white?Ch. 12 - If there is no interneuron in a reflex arc, as in...Ch. 12 - If you touch a hot stove, you reflexively...Ch. 12 - What type of neuronal circuit contains multiple...Ch. 12 - Both peripheral nerves and the white matter of the...Ch. 12 - From your understanding of the functions of myelin...Ch. 12 - What type of neurons form from neuroblasts in the...Ch. 12 - How does the development of sensory neurons...Ch. 12 - Prob. 1RQCh. 12 - Match the names of the cells in column B with the...Ch. 12 - Prob. 3RQCh. 12 - Prob. 4RQCh. 12 - An example of an effector is (a) the eye, (b) a...Ch. 12 - Prob. 6RQCh. 12 - A ganglion is a collection of (a) neuron cell...Ch. 12 - A synapse between a terminal bouton and a neuron...Ch. 12 - Myelin is most like which of the following cell...Ch. 12 - Prob. 10RQCh. 12 - Afferent neurons of the PNS synapse in the CNS...Ch. 12 - Prob. 12RQCh. 12 - Prob. 13RQCh. 12 - Place the connective tissue coverings surrounding...Ch. 12 - Define proprioception.Ch. 12 - Prob. 16RQCh. 12 - Prob. 17RQCh. 12 - Distinguish gray matter from white matter of the...Ch. 12 - What is distinctive about the appearance of a cell...Ch. 12 - Describe the differences between neurons and...Ch. 12 - Distinguish a nerve from a nerve fiber and a...Ch. 12 - Prob. 22RQCh. 12 - Draw a reflex arc in place in the nervous system...Ch. 12 - Prob. 24RQCh. 12 - Why are the cell bodies of sensory neurons located...Ch. 12 - Prob. 26RQCh. 12 - Two anatomists were arguing about a sensory...Ch. 12 - An MRI scan and other diagnostic tests indicated...Ch. 12 - Prob. 3CRCAQCh. 12 - Rochelle developed multiple sclerosis when she was...Ch. 12 - Reflexes can be somatic (as in the knee-jerk...Ch. 12 - Prob. 6CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
12 Organ Systems | Roles & functions | Easy science lesson; Author: Learn Easy Science;https://www.youtube.com/watch?v=cQIU0yJ8RBg;License: Standard youtube license