Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
9th Edition
ISBN: 9780135168035
Author: Elaine N. Marieb, Lori A. Smith
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 16RQ
Summary Introduction
To review:
The reason behind incorrectly classified proprioception as a general somatic motor as it innervates the muscles.
Introduction:
The central nervous system is the major control and coordinator of the body as it comprises the brain and the spinal cord. The brain is the most complex organ of the body and it is formed of the nerve cells that generate and transfer electrical impulses or information from one cell to another and provide communication between the body parts. Sensory neurons transfer sensory information to the central nervous system and the motor neurons transfer processed information from the central nervous system to the body parts.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 12 Solutions
Human Anatomy Laboratory Manual With Cat Dissections (9th Edition)
Ch. 12 - In which direction are afferent signals carried?...Ch. 12 - What subdivision of the nervous system regulates...Ch. 12 - What type of sensation is (a) pain from a pulled...Ch. 12 - Which type of neuron process receives stimuli?Ch. 12 - Describe how the electrical impulse from one...Ch. 12 - What is the structural type of most sensory...Ch. 12 - Which structural type of neuron is most abundant?...Ch. 12 - Which neuroglia make myelin in the CNS? In the...Ch. 12 - Which neuroglia are common in regions where...Ch. 12 - Do Schwann cells cover nonmyelinated axons in the...
Ch. 12 - Name the connective tissue wrapping that encloses...Ch. 12 - Where do synaspes occur in the CNS, in white...Ch. 12 - Why is white matter white?Ch. 12 - If there is no interneuron in a reflex arc, as in...Ch. 12 - If you touch a hot stove, you reflexively...Ch. 12 - What type of neuronal circuit contains multiple...Ch. 12 - Both peripheral nerves and the white matter of the...Ch. 12 - From your understanding of the functions of myelin...Ch. 12 - What type of neurons form from neuroblasts in the...Ch. 12 - How does the development of sensory neurons...Ch. 12 - Prob. 1RQCh. 12 - Match the names of the cells in column B with the...Ch. 12 - Prob. 3RQCh. 12 - Prob. 4RQCh. 12 - An example of an effector is (a) the eye, (b) a...Ch. 12 - Prob. 6RQCh. 12 - A ganglion is a collection of (a) neuron cell...Ch. 12 - A synapse between a terminal bouton and a neuron...Ch. 12 - Myelin is most like which of the following cell...Ch. 12 - Prob. 10RQCh. 12 - Afferent neurons of the PNS synapse in the CNS...Ch. 12 - Prob. 12RQCh. 12 - Prob. 13RQCh. 12 - Place the connective tissue coverings surrounding...Ch. 12 - Define proprioception.Ch. 12 - Prob. 16RQCh. 12 - Prob. 17RQCh. 12 - Distinguish gray matter from white matter of the...Ch. 12 - What is distinctive about the appearance of a cell...Ch. 12 - Describe the differences between neurons and...Ch. 12 - Distinguish a nerve from a nerve fiber and a...Ch. 12 - Prob. 22RQCh. 12 - Draw a reflex arc in place in the nervous system...Ch. 12 - Prob. 24RQCh. 12 - Why are the cell bodies of sensory neurons located...Ch. 12 - Prob. 26RQCh. 12 - Two anatomists were arguing about a sensory...Ch. 12 - An MRI scan and other diagnostic tests indicated...Ch. 12 - Prob. 3CRCAQCh. 12 - Rochelle developed multiple sclerosis when she was...Ch. 12 - Reflexes can be somatic (as in the knee-jerk...Ch. 12 - Prob. 6CRCAQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning