
Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.2, Problem 1CC
Nerve growth factor (NGF) is a water-soluble signaling molecule. Would you expect the receptor for NGF to be intracellular or in the plasma membrane? Why?
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
Campbell Biology (11th Edition)
Ch. 11.1 - Explain how signaling is involved in ensuring that...Ch. 11.1 - In liver cells, glycogen Phosphorylase acts in...Ch. 11.1 - Prob. 3CCCh. 11.2 - Nerve growth factor (NGF) is a water-soluble...Ch. 11.2 - WHAT IF? What would the effect be if a cell made...Ch. 11.2 - MAKE CONNECTIONS How is ligand binding similar to...Ch. 11.3 - What is a protein kinase, and what is its role in...Ch. 11.3 - When a signal transduction pathway involves a...Ch. 11.3 - What is the actual signal that is being transduced...Ch. 11.3 - WHAT IF? If you exposed a cell to a ligand that...
Ch. 11.4 - How can a targct cell's response to a single...Ch. 11.4 - WHAT IF? If two cells have different scaffolding...Ch. 11.4 - Prob. 3CCCh. 11.5 - Give an example of apoptosis during embryonic...Ch. 11.5 - WH AT IF? If apoptosis occurred when it should...Ch. 11 - What determines whether a cell responds to a...Ch. 11 - How are the structures of a GPCR and an RTK...Ch. 11 - What is the difference between a protein kinase...Ch. 11 - What mechanisms in the cell terminale its response...Ch. 11 - What is an explanation for the similarities...Ch. 11 - Binding of a signaling molecule to which type of...Ch. 11 - The activation of receptor tyrosinc kinases is...Ch. 11 - Lipid-soluble signaling molecules, such as...Ch. 11 - Consider this pathway: epinephrine G...Ch. 11 - Apoptosis involves all but which of the following?...Ch. 11 - Which Observation suggestcd to Sutherland the...Ch. 11 - Protein phosphorylation is commonly involved with...Ch. 11 - DRAW IT Draw the following apoptotic pathway,...Ch. 11 - EVOLUTION CONNECTION Identify the evolutlonary...Ch. 11 - Prob. 10TYUCh. 11 - SCIENCE, TECHNOLOGY, AND SOCIETY The aging process...Ch. 11 - WRITE ABOUT A THEME: ORGANIZATION The properties...Ch. 11 - SYNTHESIZE YOUR KNOWLEDGE There are five basic...
Additional Science Textbook Solutions
Find more solutions based on key concepts
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
The active ingredient in Tylenol and a host of other over-the-counter pain relievers is acetaminophen (C8H9NO2)...
Chemistry: Atoms First
Calculate the lattice energy of CaCl2 using a Born-Haber cycle and data from Appendices F and L and Table 7.5. ...
Chemistry & Chemical Reactivity
Why do scientists think that all forms of life on earth have a common origin?
Genetics: From Genes to Genomes
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Intro to Cell Signaling; Author: Amoeba Sisters;https://www.youtube.com/watch?v=-dbRterutHY;License: Standard youtube license