If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

Molecular Biology Question: Please help. Thank you Is Southern hybridization's purpose detecting specific nucleotide sequences? How so?

Use the following information to answer the question(s) below. Martin Wikelski and L. Michael Romero (Body size, performance and fitness in Galápagos marine iguanas, Integrative and Comparative Biology 43 [2003]:376-86) measured the snout-to-vent (anus) length of Galápagos marine iguanas and observed the percent survival of different-sized animals, all of the same age. The graph shows the log snout-vent length (SVL, a measure of overall body size) plotted against the percent survival of these different size classes for males and females. Survival (%) 100- 80- 60- 40- 20- 0+ 1.9 T 2 2.1 2.2 2.3 2.4 2.5 2.6 2.7 Log SVL (mm) 19) Examine the figure above. What type of selection for body size appears to be occurring in these marine iguanas? A) directional selection B) stabilizing selection C) disruptive selection D) You cannot determine the type of selection from the above information. 3

24) Use the following information to answer the question below. Researchers studying a small milkweed population note that some plants produce a toxin and other plants do not. They identify the gene responsible for toxin production. The dominant allele (T) codes for an enzyme that makes the toxin, and the recessive allele (t) codes for a nonfunctional enzyme that cannot produce the toxin. Heterozygotes produce an intermediate amount of toxin. The genotypes of all individuals in the population are determined (see table) and used to determine the actual allele frequencies in the population. TT 0.49 Tt 0.42 tt 0.09 Refer to the table above. Is this population in Hardy-Weinberg equilibrium? A) Yes. C) No; there are more homozygotes than expected. B) No; there are more heterozygotes than expected. D) It is impossible to tell.

Answer 2

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a. Two
b. Three
c. Four
d. Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.

Answer 12

Answer to Problem 1MCQ

Correct answer:

There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.

Answer 13

Explanation of Solution

Reason for correct statement:

Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:

BIOL:CONCEPT+INVEST.ETEXT, Chapter 11, Problem 1MCQ

As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.

Option (c) is given as “Four”.

As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.

Hence, option (c) is correct.

Reasons for the incorrect statements:

Option (a), is given as “Two”.

The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.

Option (b), is given as “Three”.

The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.

Option (d), is given as “Five”.

For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.

Hence, options (a), (b), and (d), are incorrect.

Answer 14

Conclusion

Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.