
Human Physiology: An Integrated Approach (7th Edition)
7th Edition
ISBN: 9780321981226
Author: Dee Unglaub Silverthorn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 17RQ
Summary Introduction
To determine: The reason behind the increased influx of Na+ ions as compared to the efflux of K+ ions when the nicotinic receptor allows both Na+ and K+ to move through.
Introduction: The membrane potential develops when there is a difference between the electric charge in the interior and the exterior of the cell membrane. It is mostly caused by the difference in the permeability of essential ions across the membrane. The movement of sodium (Na+) and potassium ions (K+) across the cell membrane is also based on the different concentrations of ions present on both sides of the membrane.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Chapter 11 Solutions
Human Physiology: An Integrated Approach (7th Edition)
Ch. 11 - Prob. 1CCCh. 11 - The central nervous system consists of the...Ch. 11 - Prob. 3CCCh. 11 - A nerve that carries both sensory and motor...Ch. 11 - Prob. 5CCCh. 11 - In what organelle is most intracellular Ca2+...Ch. 11 - Prob. 7CCCh. 11 - Prob. 8CCCh. 11 - Prob. 9CCCh. 11 - Prob. 10CC
Ch. 11 - Compare gating and ion selectivity of...Ch. 11 - Prob. 12CCCh. 11 - Prob. 13CCCh. 11 - Prob. 1RQCh. 11 - Prob. 2RQCh. 11 - Prob. 3RQCh. 11 - Prob. 4RQCh. 11 - Neurons that secrete acetylcholine are described...Ch. 11 - List four things that can happen to autonomic...Ch. 11 - Prob. 7RQCh. 11 - Prob. 8RQCh. 11 - Somatic motor pathways a. are excitatory or...Ch. 11 - Prob. 10RQCh. 11 - Prob. 11RQCh. 11 - Compare and contrast: a. neuroeffector junctions...Ch. 11 - Prob. 13RQCh. 11 - Create a concept map comparing the somatic motor...Ch. 11 - If a target cells receptor is _______ (use items...Ch. 11 - Ganglia contain the cell bodies of (choose all...Ch. 11 - Prob. 17RQCh. 11 - You have discovered a neuron that innervates an...Ch. 11 - Prob. 19RQCh. 11 - Prob. 20RQ
Knowledge Booster
Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Developmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage