
Pearson eText Human Anatomy -- Instant Access (Pearson+)
9th Edition
ISBN: 9780135273005
Author: Elaine Marieb, Patricia Wilhelm
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 12CYU
Summary Introduction
To review:
The actions displayed by the muscles of the posterior compartment of the thigh and the antagonists of these muscles.
Introduction:
The thigh belongs to the lower limb of the body. A dense fibrous connective tissue is responsible for the formation of anatomical compartments by the division of dorsal and ventral muscles. The muscles located in the same group exhibit similar functions while those in the opposite compartments work in the opposite manner.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 11 Solutions
Pearson eText Human Anatomy -- Instant Access (Pearson+)
Ch. 11 - Name the fascicle arrangement in a muscle whose...Ch. 11 - Prob. 2CYUCh. 11 - Which types of leavers operate at a mechanical...Ch. 11 - In a skeletal/muscular lever system, what...Ch. 11 - Most skeletal muscles of the body operate at a...Ch. 11 - Biceps brachii and brachialis both flex the...Ch. 11 - A muscle that abducts the thigh would cross the...Ch. 11 - At most joints (the knee and ankle are...Ch. 11 - Prob. 9CYUCh. 11 - Prob. 10CYU
Ch. 11 - Prob. 11CYUCh. 11 - Prob. 12CYUCh. 11 - Prob. 13CYUCh. 11 - Use your knowledge of word roots and the criteria...Ch. 11 - Prob. 15CYUCh. 11 - Describes the six movements possible at the...Ch. 11 - What muscle is the prime mover of dorsiflexion?...Ch. 11 - How do the lesser gluteals—gluteus medius and...Ch. 11 - Where is the linea alba located, and what muscles...Ch. 11 - Define the boundaries of the triangle of...Ch. 11 - Prob. 21CYUCh. 11 - Identify the body region where the following...Ch. 11 - Prob. 23CYUCh. 11 - Prob. 24CYUCh. 11 - Prob. 1RQCh. 11 - Prob. 2RQCh. 11 - Match the muscles in column B to their embryonic...Ch. 11 - The muscle that closes the eyes is (a) the...Ch. 11 - Prob. 5RQCh. 11 - Prob. 6RQCh. 11 - Prob. 7RQCh. 11 - Prob. 8RQCh. 11 - Prob. 9RQCh. 11 - Prob. 10RQCh. 11 - The major muscles used in the up portion of a...Ch. 11 - Prob. 12RQCh. 11 - Prob. 13RQCh. 11 - Define and distinguish first-, second-, and...Ch. 11 - (a) Name the four pairs of muscles that act...Ch. 11 - List all six possible movements of the humerus...Ch. 11 - (a) Name two forearm muscles that are both...Ch. 11 - (a) Name the lateral rotators of the hip. (b)...Ch. 11 - Prob. 6SAEQCh. 11 - Define (a) a fascial compartment in a limb and (b)...Ch. 11 - Name two muscles in each of the following...Ch. 11 - Prob. 9SAEQCh. 11 - Prob. 10SAEQCh. 11 - Deduce some characteristics of the following...Ch. 11 - For the following muscles, list one action of...Ch. 11 - (a) Define palpation. (b) Why is a knowledge of...Ch. 11 - Explain how one locates the proper site for...Ch. 11 - Prob. 15SAEQCh. 11 - Name the borders of the triangle of auscultation.Ch. 11 - Prob. 17SAEQCh. 11 - Prob. 1CRCAQCh. 11 - Prob. 2CRCAQCh. 11 - Assume you are trying to lift a heavy weight off...Ch. 11 - Prob. 4CRCAQCh. 11 - Prob. 5CRCAQCh. 11 - Based on its fascicle orientation, determine...Ch. 11 - Prob. 7CRCAQCh. 11 - What class of lever is described by the following...Ch. 11 - Walking to her car after her 65th birthday party,...Ch. 11 - An athletic trainer was examining a college...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
GCSE PE - ANTAGONISTIC MUSCLE ACTION - Anatomy and Physiology (Skeletal and Muscular System - 1.5); Author: igpe_complete;https://www.youtube.com/watch?v=6hm_9jQRoO4;License: Standard Youtube License