The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame. Introduction: The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology . They are used as reporter genes isolated from the firefly Photinus pyralis . When luciferase acts on the appropriate luciferin substrate, light is emitted. Â The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing. It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Question

Want to see the full answer?

Answer 1

Question

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?

What is amplification bias?

What would happen if transcriptome analysis were done on liver and muscle cells?

Answer 2

Question

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Answer 6

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Answer 7

Chapter 10.5, Problem 1TQ

Summary Introduction

To review:

The results of fusion of a promoter for an SOS response gene with the luciferase open reading frame.

Introduction:

The class of oxidative enzymes that produces bioluminescence is defined as luciferase. They have wide applications in the field of biotechnology. They are used as reporter genes isolated from the firefly Photinuspyralis. When luciferase acts on the appropriate luciferin substrate, light is emitted.

Â

The reporter genes are nucleic acid sequences that encode products that can be detected in the transformed tissues. They are often used as indicators of whether a specific gene has been expressed in the organism or not. The genes that code for luciferase can serve as reporter genes as their expression is easy to monitor. Luciferase possesses some features that make them useful particularly as a reporter molecule for biosensing.

It can be used as a real-time biosensor for environmental stress response. RecA (recombination A) protein that is stimulated by the single-stranded DNA (deoxyribonucleic acid) is involved in the inactivation of the repressor (LexA) of SOS response genes, which induce the response. The fusion of the luciferase gene with a recA promoter will show an increase in the fluorescence after the irradiation by ultraviolet light by putting the culture into a spectrophotometer.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 10.1 - Prob. 1TQ Ch. 10.2 - Prob. 1TQ Ch. 10.2 - Prob. 2TQ Ch. 10.2 - Prob. 3TQ Ch. 10.2 - Prob. 4TQ Ch. 10.2 - Prob. 5TQ Ch. 10.3 - Prob. 1TQ Ch. 10.3 - Prob. 2TQ Ch. 10.4 - Prob. 1TQ Ch. 10.5 - Prob. 1TQ

Concept explainers

Videos

Want to see the full answer?

Chapter 10 Solutions