MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
4th Edition
ISBN: 9780393622805
Author: SLONCZEWSKI
Publisher: Norton custom
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.2, Problem 1TQ
Summary Introduction
To review:
The translation of lacY gene when the lacZ gene has a nonsense mutation in its open reading frame.
Introduction:
The mutation or substitution of a single base pair in a DNA (deoxyribonucleic acid) sequence resulting in a premature stop codon is called a nonsense mutation. Its presence leads to the production of a non-functional or shortened protein. Lac operon also known as lactose operon is a group of genes that encodes for enzymes essential for the utilization of lactose as a source of energy.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 10 Solutions
MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
Ch. 10.1 - Prob. 1TQCh. 10.2 - Prob. 1TQCh. 10.2 - Prob. 2TQCh. 10.2 - Prob. 3TQCh. 10.2 - Prob. 4TQCh. 10.2 - Prob. 5TQCh. 10.3 - Prob. 1TQCh. 10.3 - Prob. 2TQCh. 10.4 - Prob. 1TQCh. 10.5 - Prob. 1TQ
Ch. 10.5 - Prob. 2TQCh. 10.6 - Prob. 1TQCh. 10 - Prob. 1RQCh. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - Prob. 6RQCh. 10 - Prob. 7RQCh. 10 - Prob. 8RQCh. 10 - Prob. 9RQCh. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - Prob. 13RQCh. 10 - Prob. 14RQCh. 10 - Prob. 1TQCh. 10 - Prob. 2TQCh. 10 - Prob. 3TQCh. 10 - Prob. 4TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning


Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license