
Concept explainers
Introduction:
In animals the sexual life cycle involves meiosis. Meiosis involves two consecutive cell divisions called meiosis I and meiosis II. In meiosis I the stages are interphase I, prophase I, metaphase I, anaphase I and telophase I. during interphase I cells carry out cellular activities, replication of DNA and synthesis of proteins.

Answer to Problem 5A
Correct answer :
The correct answer is option D. metaphase II
Explanation of Solution
Explanation/justification for the correct answer:
OptionD. metaphase II- This is the second stage in meiosis II. In this phase the haploid chromosomes line up at the cell’s equator. The spindle fibers attach to the centromere of each chromosome. As can be seen in the given diagram, the haploid chromosomes are lined up at the equator of the cell. Hence, this is the correct option.
Explanation for incorrect answer:
Option A. prophase I- During this process the replicated chromosomes appear as two sister chromatids. The homologous chromosomes condense and begin to form pairs in a process called synapsis. Some segments of homologous chromosomes get exchanged during synapsis. This process is called crossing over. In this phase the chromosomes do not line up at the cell’s equator. Hence, this is not the correct option.
Option B. prophase II- In this phase the chromosomes do not line up at the cell’s equator. A second set of phases start with spindle apparatus being formed and the chromosomes condense. Hence, this is not the correct option.
Option C. metaphase I- This is the second stage in meiosis I. In this phase the pairs of homologous chromosomes line up at the cell’s equator. The spindle fibers attach to the centromere of each homologous chromosome. As can be seen in the given diagram, the pairs of homologous chromosomes are not lined up at the equator of the cell. Only haploid chromosomes are lined up at the equator. Hence, this is not the correct option.
Chapter 10 Solutions
Glencoe Biology (Glencoe Science)
Additional Science Textbook Solutions
Biology: Life on Earth (11th Edition)
Human Anatomy & Physiology (2nd Edition)
Campbell Biology (11th Edition)
Introductory Chemistry (6th Edition)
Chemistry: The Central Science (14th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





