
Concept explainers
Introduction:
In animals the sexual life cycle involves meiosis. Meiosis involves two consecutive cell divisions called meiosis I and meiosis II. In meiosis I and II, the stages are prophase I and II, metaphase Iand II, anaphase Iand II and telophase Iand II.

Answer to Problem 8STP
Correct answer :
The correct answer is option B. anaphase II
Explanation of Solution
Explanation/justification for the correct answer:
OptionB. anaphase II- This is the third stage in meiosis II. In this phase the centromeres split and sister chromatids separate and move to opposite poles. Hence, this is the correct option.
Explanation for incorrect answer:
Option A. anaphase I- During this process the homologous chromosomes separate and move to opposite poles of the cell. Hence, this is not the correct option.
Option C. telophase I- In this phase the spindles break down and the chromosomes uncoil and form two nuclei. The cell divides to form two daughter cells.Hence, this is not the correct option.
Option D. telophase II- In this phase the spindle breaks down and four nuclei forms around chromosomes. Cells divide and form four daughter cells. Hence, this is not the correct option.
Chapter 10 Solutions
Glencoe Biology (Glencoe Science)
Additional Science Textbook Solutions
Biology: Life on Earth (11th Edition)
Cosmic Perspective Fundamentals
Anatomy & Physiology (6th Edition)
Human Physiology: An Integrated Approach (8th Edition)
Introductory Chemistry (6th Edition)
Campbell Biology in Focus (2nd Edition)
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





