Concept explainers
Videos
Introduction:
A cell grows until it reaches its size limit, then it either stops growing or divides. Most cells undergo division. Cell division helps a cell to reproduce and makes the organism grow and heal certain injuries.
Answer to Problem 3STP
Correct answer :
The correct answer is option D. mitosis
Explanation of Solution
Explanation/justification for the correct answer:
Option D.Mitosis- The second stage in a cell cycle is mitosis in which cell’s nucleus and nuclear material divides. In this stage the cell’s replicated genetic material separates and the cell prepares to split into two cells. There are four stages in mitosis; prophase, metaphase, anaphase and telophase.
Prophase- This is the first stage in which nuclear membrane disintegrates, nucleolus disappears, chromosomes condense and mitotic spindle begins to form between the poles of the cell.
Metaphase- In this stage the chromosomes attach to mitotic spindle and align along the equator of the cell.
Anaphase- In this stage, the microtubules shorten, moving the chromosomes to opposite poles.
Telophase- This is the last stage in which the chromosomes reach the poles of the cell, nuclear envelope forms again, nucleolus reappears and chromosomes decondense.
Explanation for incorrect answer:
Option A. cell cycle- Cells reproduce by a cycle of growing and dividing called the cell cycle.There are three main stages of a cell cycle; interphase, mitosis and cytokinesis. The entire sequence of events in the life of a eukaryotic cell is called cell cycle. Hence this is not the correct option.
Option B. cytokinesis-The last stage of cell cycle is cytokinesis in which the cytoplasm of the cell divided creating a new cell. The nuclear material and nucleus does not divide in this stage. Hence this is not the correct option.
Option C. interphase- A cell spends most of the time in interphase. It is the stage in which a cell grows, carries out cellular activities and
Chapter 10 Solutions
Glencoe Biology (Glencoe Science)
Additional Science Textbook Solutions
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Chemistry: Structure and Properties (2nd Edition)
Brock Biology of Microorganisms (15th Edition)
Campbell Biology in Focus (2nd Edition)
Cosmic Perspective Fundamentals
Biology: Life on Earth (11th Edition)
- Biology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forwardWrite the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forward
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education