
EBK SEELEY'S ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781259671166
Author: VanPutte
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 3CT
Summary Introduction
To determine:
The neck muscles that can be injured in a whiplash injury due to rear-end auto collision along with the preventive measures of that injury.
Introduction:
The majority of muscles in the body are formed by skeletal muscles. They comprise about 40% of the total body weight of a human. Skeletal muscles are normally connected to bones with the help of tendons. The tendons are made up of collagen. A skeletal muscle is a group of muscle cells called muscle fibers, as similar to a nerve which is a group of neurons. The long and cylindrical cell containing up to about a hundred nuclei and present near the surface of the fiber is called a muscle fiber.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 10 Solutions
EBK SEELEY'S ANATOMY & PHYSIOLOGY
Ch. 10.1 - Distinguish between the origin and the insertion...Ch. 10.1 - Describe the roles of the following in muscle...Ch. 10.1 - Describe the different orientations of muscle...Ch. 10.1 - What geometric shapes can muscles have?Ch. 10.1 - List the criteria used to name muscles, and give...Ch. 10.1 - Using the terms fulcrum, lever, and force, explain...Ch. 10.1 - Describe the three classes of levers, and give on...Ch. 10.2 - Name the major movements of the head caused by...Ch. 10.2 - What is unusual about the insertion (and sometimes...Ch. 10.2 - Which muscles ore responsible for moving the ears,...
Ch. 10.2 - What usually causes ptosis on one side? Which...Ch. 10.2 - Name the muscles responsible for opening and...Ch. 10.2 - Prob. 13AYPCh. 10.2 - Contrast the movements produced by the extrinsic...Ch. 10.2 - Explain the interaction of the suprahyoid and...Ch. 10.2 - Prob. 16AYPCh. 10.2 - Describe the muscles of the eye and the movements...Ch. 10.3 - List the actions of the group of back muscles that...Ch. 10.3 - Prob. 19AYPCh. 10.3 - Explain the anatomical basis for the segments...Ch. 10.3 - What openings penetrate the pelvic diaphragm...Ch. 10.4 - Name the seven muscles that attach the scapula to...Ch. 10.4 - Prob. 23AYPCh. 10.4 - What muscles cause flexion and extension of the...Ch. 10.4 - Prob. 25AYPCh. 10.4 - Prob. 26AYPCh. 10.4 - Prob. 27AYPCh. 10.4 - Prob. 28AYPCh. 10.4 - Prob. 29AYPCh. 10.4 - Describe the muscles that move the thumb. The...Ch. 10.5 - Prob. 31AYPCh. 10.5 - Prob. 32AYPCh. 10.5 - Prob. 33AYPCh. 10.5 - What movement do the fibularis muscles nave in...Ch. 10.5 - Prob. 35AYPCh. 10.5 - Prob. 36AYPCh. 10 - Muscles that oppose one mother are a. synergists....Ch. 10 - The most movable attachment of a muscle is its a....Ch. 10 - The muscle whose name means it is to the side of...Ch. 10 - In a class III lever system, them a. fulcrum is...Ch. 10 - Prob. 5RACCh. 10 - An aerial circus performer who supports her body...Ch. 10 - Prob. 7RACCh. 10 - Prob. 8RACCh. 10 - The soft palate muscles a. prevent food from...Ch. 10 - Prob. 10RACCh. 10 - Prob. 11RACCh. 10 - Prob. 12RACCh. 10 - Prob. 13RACCh. 10 - Prob. 14RACCh. 10 - Prob. 15RACCh. 10 - Prob. 16RACCh. 10 - Which of these muscles is an antagonist of the...Ch. 10 - Prob. 18RACCh. 10 - Which of these muscles is an intrinsic hand muscle...Ch. 10 - Given these muscles: Iliopsoas Rectus femoris...Ch. 10 - Prob. 21RACCh. 10 - Prob. 22RACCh. 10 - The ________________ muscles evert the foot,...Ch. 10 - Prob. 24RACCh. 10 - For each of the following muscles: (1) describe...Ch. 10 - Consider only the effect of the brachioradialis...Ch. 10 - Prob. 3CTCh. 10 - Prob. 4CTCh. 10 - When a person becomes Unconscious, the tongue...Ch. 10 - Prob. 6CTCh. 10 - Savannah started a 200-meter dash and fell to the...Ch. 10 - Prob. 8CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningFundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Animal Communication | Ecology & Environment | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=LsMbn3b1Bis;License: Standard Youtube License