
EBK SEELEY'S ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781259671166
Author: VanPutte
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10.5, Problem 36AYP
Summary Introduction
To describe:
The general actions that are performed by the intrinsic foot muscles.
Introduction:
The muscles that are located within the foot are known as intrinsic foot muscles and example of some intrinsic foot muscles are adductor hallucis, abductor hallucis, and flexor hallucis brevis.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What would happen if transcriptome analysis were done on liver and muscle cells?
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
Chapter 10 Solutions
EBK SEELEY'S ANATOMY & PHYSIOLOGY
Ch. 10.1 - Distinguish between the origin and the insertion...Ch. 10.1 - Describe the roles of the following in muscle...Ch. 10.1 - Describe the different orientations of muscle...Ch. 10.1 - What geometric shapes can muscles have?Ch. 10.1 - List the criteria used to name muscles, and give...Ch. 10.1 - Using the terms fulcrum, lever, and force, explain...Ch. 10.1 - Describe the three classes of levers, and give on...Ch. 10.2 - Name the major movements of the head caused by...Ch. 10.2 - What is unusual about the insertion (and sometimes...Ch. 10.2 - Which muscles ore responsible for moving the ears,...
Ch. 10.2 - What usually causes ptosis on one side? Which...Ch. 10.2 - Name the muscles responsible for opening and...Ch. 10.2 - Prob. 13AYPCh. 10.2 - Contrast the movements produced by the extrinsic...Ch. 10.2 - Explain the interaction of the suprahyoid and...Ch. 10.2 - Prob. 16AYPCh. 10.2 - Describe the muscles of the eye and the movements...Ch. 10.3 - List the actions of the group of back muscles that...Ch. 10.3 - Prob. 19AYPCh. 10.3 - Explain the anatomical basis for the segments...Ch. 10.3 - What openings penetrate the pelvic diaphragm...Ch. 10.4 - Name the seven muscles that attach the scapula to...Ch. 10.4 - Prob. 23AYPCh. 10.4 - What muscles cause flexion and extension of the...Ch. 10.4 - Prob. 25AYPCh. 10.4 - Prob. 26AYPCh. 10.4 - Prob. 27AYPCh. 10.4 - Prob. 28AYPCh. 10.4 - Prob. 29AYPCh. 10.4 - Describe the muscles that move the thumb. The...Ch. 10.5 - Prob. 31AYPCh. 10.5 - Prob. 32AYPCh. 10.5 - Prob. 33AYPCh. 10.5 - What movement do the fibularis muscles nave in...Ch. 10.5 - Prob. 35AYPCh. 10.5 - Prob. 36AYPCh. 10 - Muscles that oppose one mother are a. synergists....Ch. 10 - The most movable attachment of a muscle is its a....Ch. 10 - The muscle whose name means it is to the side of...Ch. 10 - In a class III lever system, them a. fulcrum is...Ch. 10 - Prob. 5RACCh. 10 - An aerial circus performer who supports her body...Ch. 10 - Prob. 7RACCh. 10 - Prob. 8RACCh. 10 - The soft palate muscles a. prevent food from...Ch. 10 - Prob. 10RACCh. 10 - Prob. 11RACCh. 10 - Prob. 12RACCh. 10 - Prob. 13RACCh. 10 - Prob. 14RACCh. 10 - Prob. 15RACCh. 10 - Prob. 16RACCh. 10 - Which of these muscles is an antagonist of the...Ch. 10 - Prob. 18RACCh. 10 - Which of these muscles is an intrinsic hand muscle...Ch. 10 - Given these muscles: Iliopsoas Rectus femoris...Ch. 10 - Prob. 21RACCh. 10 - Prob. 22RACCh. 10 - The ________________ muscles evert the foot,...Ch. 10 - Prob. 24RACCh. 10 - For each of the following muscles: (1) describe...Ch. 10 - Consider only the effect of the brachioradialis...Ch. 10 - Prob. 3CTCh. 10 - Prob. 4CTCh. 10 - When a person becomes Unconscious, the tongue...Ch. 10 - Prob. 6CTCh. 10 - Savannah started a 200-meter dash and fell to the...Ch. 10 - Prob. 8CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Developmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forwardBiology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Fundamentals of Sectional Anatomy: An Imaging App...
Biology
ISBN:9781133960867
Author:Denise L. Lazo
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Chapter 7 - Human Movement Science; Author: Dr. Jeff Williams;https://www.youtube.com/watch?v=LlqElkn4PA4;License: Standard youtube license