Biochemistry
9th Edition
ISBN: 9781305961135
Author: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 21RE
RECALL Describe the discontinuous synthesis of the lagging strand in
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across
from the nucleotide C
template ATGCAGCTCCAGTCGGTAATG
new strand
O none of answers correct
O Tor A
O A
Chapter 10 Solutions
Biochemistry
Ch. 10 - RECALL Define replication, transcription, and...Ch. 10 - REFLECT AND APPLY Is the following statement true...Ch. 10 - REFLECT AND APPLY Why is it more important for DNA...Ch. 10 - RECALL Why is the replication of DNA referred to...Ch. 10 - RECALL What is a replication fork? Why is it...Ch. 10 - Prob. 6RECh. 10 - RECALL Why is it necessary to unwind the DNA helix...Ch. 10 - REFLECT AND APPLY In the MeselsonStahl experiment...Ch. 10 - REFLECT AND APPLY Suggest a reason why it would be...Ch. 10 - RECALL Do DNA-polymerase enzymes also function as...
Ch. 10 - RECALL Compare and contrast the properties of the...Ch. 10 - REFLECT AND APPLY Define processivity, and...Ch. 10 - REFLECT AND APPLY Comment on the dual role of the...Ch. 10 - REFLECT AND APPLY What is the importance of...Ch. 10 - REFLECT AND APPLY DNA synthesis always takes place...Ch. 10 - REFLECT AND APPLY What would happen to the...Ch. 10 - Prob. 17RECh. 10 - REFLECT AND APPLY Why is it not surprising that...Ch. 10 - Prob. 19RECh. 10 - RECALL List the substances required for...Ch. 10 - RECALL Describe the discontinuous synthesis of the...Ch. 10 - RECALL What are the functions of the gyrase,...Ch. 10 - RECALL Single-stranded regions of DNA are attacked...Ch. 10 - RECALL Describe the role of DNA ligase in the...Ch. 10 - RECALL What is the primer in DNA replication?Ch. 10 - Prob. 26RECh. 10 - REFLECT AND APPLY Why is a short RNA primer needed...Ch. 10 - Prob. 28RECh. 10 - RECALL What was the recent change in the estimated...Ch. 10 - Prob. 30RECh. 10 - RECALL Why is a clamp loader necessary in...Ch. 10 - RECALL How does proofreading take place in the...Ch. 10 - Prob. 33RECh. 10 - Prob. 34RECh. 10 - BIOCHEMICAL CONNECTIONS Of what benefit is it for...Ch. 10 - REFLECT AND APPLY Your book contains about 2...Ch. 10 - REFLECT AND APPLY E. coli incorporates...Ch. 10 - REFLECT AND APPLY Given the typing speed from...Ch. 10 - Prob. 39RECh. 10 - REFLECT AND APPLY How can breakdown in DNA repair...Ch. 10 - Prob. 41RECh. 10 - RECALL What is a direct way of repairing...Ch. 10 - Prob. 43RECh. 10 - Prob. 44RECh. 10 - Prob. 45RECh. 10 - Prob. 46RECh. 10 - RECALL How did Messelson and Weigle demonstrate...Ch. 10 - Prob. 48RECh. 10 - RECALL What is the Holliday Model?Ch. 10 - RECALL Do eukaryotes have fewer origins of...Ch. 10 - RECALL How does DNA replication in eukaryotes...Ch. 10 - Prob. 52RECh. 10 - REFLECT AND APPLY (a) Eukaryotic DNA replication...Ch. 10 - Prob. 54RECh. 10 - Prob. 55RECh. 10 - Prob. 56RECh. 10 - Prob. 57RECh. 10 - Prob. 58RECh. 10 - Prob. 59RECh. 10 - Prob. 60RECh. 10 - Prob. 61RECh. 10 - Prob. 62RECh. 10 - Prob. 63RECh. 10 - Prob. 64RE
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- REFLECT AND APPLY In the MeselsonStahl experiment that established the semiconservative nature of DNA replication, the extraction method produced short fragments of DNA. What sort of results might have been obtained with longer pieces of DNA?arrow_forwardREFLECT AND APPLY Suggest a reason why it would be unlikely for replication to take place without unwinding the DNA helix.arrow_forwardRECALL Describe the role of DNA ligase in the replication process.arrow_forward
- REFLECT AND APPLY Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could type with the accuracy with which the prokaryote E. coli incorporates, proofreads, and repairs bases in replication (about one uncorrected error in 109to1010 bases), how many such books would you have to type before an uncorrected error is permitted? (Assume that the error rate is one in 1010 bases.)arrow_forwardREFLECT AND APPLY A technology called PCR is used for replicating large quantities of DNA in forensic science (Chapter 13). With this technique, DNA is separated by heating with an automated system. Why is information about the DNA sequence needed to use this technique?arrow_forwardRECALL List several ways in which RNA is processed after transcription.arrow_forward
- REFLECT AND APPLY E. coli incorporates deoxyribonucleotides into DNA at a rate of 250 to 1000 bases per second. Using the higher value, translate this into typing speed in words per minute. (Assume five characters per word, using the typing analogy from Question 36.)arrow_forwardREFLECT AND APPLY Give the DNA sequence for the template strand that gives rise to the following sequence gel, prepared using the Sanger method with a radioactive label at the 5' end of the primer.arrow_forwardRECALL Are the sequences shown in Question 6 those of RNA or DNA? How can you tell?arrow_forward
- RECALL How does proofreading take place in the process of DNA replication?arrow_forwardREFLECT AND APPLY What difficulties arise in the polymerase chain reaction if there is contamination of the DNA that is to be copied?arrow_forwardREFLECT AND APPLY List three mechanisms that relax the twisting stress in helical DNA molecules.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY