HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
19th Edition
ISBN: 9780135672990
Author: AMERMAN
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 1CYU
Summary Introduction
To review:
Whether large motor units are present in the postural muscles of the back or the muscles of the hand. Also, mention the rationale behind this.
Introduction:
A motor unit of the muscle comprises a motor neuron and skeletal muscle fibers innervated by the axon terminals of the motor neuron. The size of the motor unit depends on the factors like type of muscle, type of work accomplished by the muscle, and location of the muscle. Fine control of the movements is important in determining the size of a motor unit.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 10 Solutions
HUMAN ANA.+PHYS.W/LAB MANUAL >BCI<
Ch. 10.1 - What are the two types of striated muscle?Ch. 10.1 - Which two types of muscle are involuntary?Ch. 10.1 - What is the basic function of all types of muscle...Ch. 10.1 - 4. What five properties are common to all muscle...Ch. 10.1 - Prob. 5QCCh. 10.2 - Prob. 1QCCh. 10.2 - How are the terminal cisternae related to the...Ch. 10.2 - Prob. 3QCCh. 10.2 - How does the arrangement of myofilaments produce...Ch. 10.2 - 5. Describe the structure of a sarcomere. What is...
Ch. 10.2 - Prob. 6QCCh. 10.2 - Describe the structures of thin filaments, thick...Ch. 10.2 - Prob. 8QCCh. 10.3 - What is the resting membrane potential?Ch. 10.3 - Prob. 2QCCh. 10.3 - 3. How do the electrochemical gradients for...Ch. 10.3 - What two factors generate the resting membrane...Ch. 10.3 - What is an action potential?Ch. 10.3 - What happens during the two phases of an action...Ch. 10.4 - Prob. 1QCCh. 10.4 - Prob. 2QCCh. 10.4 - 3. How does excitation from a neuron trigger...Ch. 10.4 - How are excitation and contraction coupled?Ch. 10.4 - What are the steps of the crossbridge cycle?Ch. 10.4 - Prob. 6QCCh. 10.5 - What are the two immediate energy sources for...Ch. 10.5 - How long can these immediate energy sources fuel...Ch. 10.5 - Prob. 3QCCh. 10.5 - Prob. 4QCCh. 10.5 - Prob. 5QCCh. 10.5 - Prob. 6QCCh. 10.5 - Prob. 7QCCh. 10.6 - What is a twitch contraction?Ch. 10.6 - What are the phases of a twitch contraction?Ch. 10.6 - How does the timing of a stimulus impact the...Ch. 10.6 - 4. How do fused and unfused tetanus differ?
Ch. 10.6 - 5. At what length will a sarcomere be able to...Ch. 10.6 - How do type I and type II muscle fibers differ?Ch. 10.7 - Prob. 1QCCh. 10.7 - 2. Explain the process of recruitment.
Ch. 10.7 - Prob. 3QCCh. 10.7 - 4. How do isotonic concentric, isotonic...Ch. 10.8 - Prob. 1QCCh. 10.8 - Prob. 2QCCh. 10.8 - Prob. 3QCCh. 10.8 - What conditions does excess postexercise oxygen...Ch. 10 - Mark the following statements as true or false. If...Ch. 10 - How does a skeletal muscle fiber differ...Ch. 10 - Thick filaments are composed of the protein a....Ch. 10 - Prob. 4CYRCh. 10 - Prob. 5CYRCh. 10 - Mark the following statements as true or false. If...Ch. 10 - Prob. 7CYRCh. 10 - 8. Order the following events of excitation and...Ch. 10 - 9. Which of the following statements accurately...Ch. 10 - 10. A muscle fiber relaxes when:
a. the...Ch. 10 - Which of the following energy sources would...Ch. 10 - 12. Mark the following statements as true or...Ch. 10 - Prob. 13CYRCh. 10 - 14. Muscle tone is:
a. the result of voluntary...Ch. 10 - Prob. 15CYRCh. 10 - Which of the following is not likely to result...Ch. 10 - Which of the following factors is/are responsible...Ch. 10 - 18. What is thought to cause excess postexercise...Ch. 10 - Prob. 19CYRCh. 10 - 20. Which of the following best describes...Ch. 10 - Mark the following statements as true for smooth...Ch. 10 - Prob. 1CYUCh. 10 - Prob. 2CYUCh. 10 - 3. The drug neostigmine blocks the activity of...Ch. 10 - Explain why cardiac muscle cells and some smooth...Ch. 10 - Prob. 1AYKACh. 10 - Prob. 2AYKACh. 10 - Prob. 3AYKACh. 10 - Prob. 4AYKACh. 10 - Prob. 5AYKBCh. 10 - Prob. 6AYKB
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Nervous System - Get to know our nervous system a bit closer, how does it works? | Neurology; Author: FreeMedEducation;https://www.youtube.com/watch?v=6O-0CVAgaEM;License: Standard youtube license