Human Anatomy
9th Edition
ISBN: 9780135168059
Author: Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, Jon
Publisher: Pearson Education, Inc.,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 1CYU
What is the difference between histology and radiography?
Expert Solution & Answer
Summary Introduction
To review:
The difference between radiography and histology.
Introduction:
Anatomy can be defined as the branch of science that concerns with the identification as well as description of the body structures of living organisms. Several branches are included in the field of anatomy. Gross anatomy is one such branch and it includes the study of body features for which examination is possible with the naked eye.Â
Explanation of Solution
Histology or microscopic anatomy includes the study of the structures that are only able to be observed with a microscope. The structures like cells and tissues are the main factors to study in histology and microscopic anatomy. Radiography is another branch of anatomical studies. Differences between histology and radiography are described below:
Want to see more full solutions like this?
Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 1 Solutions
Human Anatomy
Ch. 1 - What is the difference between histology and...Ch. 1 - Use the word root definitions located in the end...Ch. 1 - Define a tissue. List the four types of tissues in...Ch. 1 - Name the organ system described in each of the...Ch. 1 - Using directional terms, desc1ibe the location of...Ch. 1 - Prob. 6CYUCh. 1 - What is the outer layer of serous membrane that...Ch. 1 - In tissue stained with H&E stain, what color are...Ch. 1 - Prob. 9CYUCh. 1 - What imaging technique is best suited for each of...
Ch. 1 - The correct sequence of levels forming the...Ch. 1 - Using the terms listed below, fill in the blank...Ch. 1 - Match each anatomical term for body regions listed...Ch. 1 - Which of these organs would not be cut by a...Ch. 1 - State whether each structure listed below is part...Ch. 1 - Indicate whether each of the following conditions...Ch. 1 - Prob. 7RQCh. 1 - The ventral surface of the body is the same as its...Ch. 1 - Match each serous membrane in column B with its...Ch. 1 - Prob. 10RQCh. 1 - Histology is the same as ta) pathological anatomy,...Ch. 1 - Describe the anatomical position and then assume...Ch. 1 - Identify the organ system that each group of...Ch. 1 - (a) Define bilateral symmetry. (b) Although many...Ch. 1 - The following advanced imaging techniques are...Ch. 1 - Give the formal regional term for each of these...Ch. 1 - Prob. 17RQCh. 1 - Construct sentences that use the following...Ch. 1 - The main cavities of the body include the...Ch. 1 - Where would you be injured it you pulled a muscle...Ch. 1 - (a) The human body is designed as a tube within a...Ch. 1 - Dominic's doctors strongly suspect he has a tumor...Ch. 1 - The Nguyen family was traveling in their van and...Ch. 1 - A patient had a hernia in his inguinal region,...Ch. 1 - A woman fell off a motorcycle. She tore a nerve in...Ch. 1 - New anatomy students oiten mix up the terms spinal...Ch. 1 - Using the list of word roots located at the...
Additional Science Textbook Solutions
Find more solutions based on key concepts
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science (6th Edition)
Practice Exercise 1
Which of the following factors determines the size of an atom? a. the volume of the nucleus...
Chemistry: The Central Science (14th Edition)
How could you separate a mixture of the following compounds? The reagents available to you are water, either, 1...
Organic Chemistry (8th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
Label each statement about the polynucleotide ATGGCG as true or false. The polynucleotide has six nucleotides. ...
General, Organic, and Biological Chemistry - 4th edition
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
HEALTH ASSESSMENT TIPS | For Nursing and NP Students; Author: Nurse Liz;https://www.youtube.com/watch?v=ihQ-VSep4nI;License: Standard Youtube License