
Human Anatomy
9th Edition
ISBN: 9780135168059
Author: Marieb, Elaine Nicpon, Brady, Patricia, Mallatt, Jon
Publisher: Pearson Education, Inc.,
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 1, Problem 9CYU
Summary Introduction
To review:
The type of microscopy used to get a clear three-dimensional image of the surface feature of a structure.
Introduction:
Microscopy is the science that deals with imaging of the objects that cannot be seen by unaided eyes. The field of microscopy is completely dependent on the microscope for imaging of the subjected objects. The microscope is a machine that is widely used to view nanostructures.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 1 Solutions
Human Anatomy
Ch. 1 - What is the difference between histology and...Ch. 1 - Use the word root definitions located in the end...Ch. 1 - Define a tissue. List the four types of tissues in...Ch. 1 - Name the organ system described in each of the...Ch. 1 - Using directional terms, desc1ibe the location of...Ch. 1 - Prob. 6CYUCh. 1 - What is the outer layer of serous membrane that...Ch. 1 - In tissue stained with H&E stain, what color are...Ch. 1 - Prob. 9CYUCh. 1 - What imaging technique is best suited for each of...
Ch. 1 - The correct sequence of levels forming the...Ch. 1 - Using the terms listed below, fill in the blank...Ch. 1 - Match each anatomical term for body regions listed...Ch. 1 - Which of these organs would not be cut by a...Ch. 1 - State whether each structure listed below is part...Ch. 1 - Indicate whether each of the following conditions...Ch. 1 - Prob. 7RQCh. 1 - The ventral surface of the body is the same as its...Ch. 1 - Match each serous membrane in column B with its...Ch. 1 - Prob. 10RQCh. 1 - Histology is the same as ta) pathological anatomy,...Ch. 1 - Describe the anatomical position and then assume...Ch. 1 - Identify the organ system that each group of...Ch. 1 - (a) Define bilateral symmetry. (b) Although many...Ch. 1 - The following advanced imaging techniques are...Ch. 1 - Give the formal regional term for each of these...Ch. 1 - Prob. 17RQCh. 1 - Construct sentences that use the following...Ch. 1 - The main cavities of the body include the...Ch. 1 - Where would you be injured it you pulled a muscle...Ch. 1 - (a) The human body is designed as a tube within a...Ch. 1 - Dominic's doctors strongly suspect he has a tumor...Ch. 1 - The Nguyen family was traveling in their van and...Ch. 1 - A patient had a hernia in his inguinal region,...Ch. 1 - A woman fell off a motorcycle. She tore a nerve in...Ch. 1 - New anatomy students oiten mix up the terms spinal...Ch. 1 - Using the list of word roots located at the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College