Fundamentals of Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134396026
Author: Frederic H. Martini, Judi L. Nath, Edwin F. Bartholomew
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 13CP
Define eponym.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 1 Solutions
Fundamentals of Anatomy & Physiology (11th Edition)
Ch. 1 - Describe a learning outcome.Ch. 1 - Explain how to use your textbook most effectively...Ch. 1 - Define anatomy.Ch. 1 - Define physiology.Ch. 1 - Describe how anatomy and physiology are closely...Ch. 1 - What is the difference between gross anatomy and...Ch. 1 - Identify several specialties of physiology.Ch. 1 - Why is it difficult to separate anatomy from...Ch. 1 - Identify the major levels of organization of the...Ch. 1 - Identify the organ systems of the body and cite...
Ch. 1 - At which level of organization does a histologist...Ch. 1 - Prob. 12CPCh. 1 - Define eponym.Ch. 1 - Name the book that serves as the international...Ch. 1 - What is the purpose of anatomical terms?Ch. 1 - For a body in the anatomical position, describe an...Ch. 1 - Name two essential functions of the body cavities...Ch. 1 - Describe the various body cavities of the trunk.Ch. 1 - Define homeostasis.Ch. 1 - Which general mechanism of homeostatic regulation...Ch. 1 - Why is homeostatic regulation important to an...Ch. 1 - Prob. 22CPCh. 1 - What happens to the body when homeostasis breaks...Ch. 1 - Prob. 24CPCh. 1 - Prob. 25CPCh. 1 - Define equilibrium.Ch. 1 - When the body continuously adapts by using...Ch. 1 - LEVEL 1 Reviewing Facts and Terms 1. Label the...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - 2. cytology (a) study of tissues 3. physiology (b)...Ch. 1 - Prob. 17RQCh. 1 - The study of the structure of tissues is called...Ch. 1 - The increasingly forceful labor contractions...Ch. 1 - Prob. 20RQCh. 1 - A plane through the body that passes perpendicular...Ch. 1 - Prob. 22RQCh. 1 - Prob. 23RQCh. 1 - A learning outcome is best described as (a) a goal...Ch. 1 - (a) Define anatomy. (b) Define physiology.Ch. 1 - The two major body cavities of the trunk are the...Ch. 1 - What distinguishes autoregulation from extrinsic...Ch. 1 - Describe the anatomical position.Ch. 1 - Which sectional plane could divide the body so...Ch. 1 - Prob. 30RQCh. 1 - Prob. 31RQCh. 1 - Prob. 32RQCh. 1 - Besides the liver and most of the large intestine,...Ch. 1 - If the deep knife wound had been superior to the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY