Without Inhibitor [substrate], mM Rate (Vo), mM/min 0.997774599 With Inhibitor Rate (Vo), mM/min 0.847401 1 1.5 1.076855826 0.973852 2 1.122873947 1.037991 2.5 1.160626292 1.068431 3 1.184072485 1.105866
Q: You have a sample – sample 1 - that has a concentration (✗) particles. From this you take 1 mL and…
A: Dilution is the lab procedure used for lowering the concentration of the solute in a solution by…
Q: d. e. fo HO -OH NH2 n blood HO n H3C SCOA OH HO NH CH3
A: Reactions mechanisms are basically jumping of electrons within and between the reactants. Based on…
Q: 8 From the Hill Plot below, the of the first binding event for the receptor-ligand system under…
A: The hill plot is a graph drawn based on the Hill equation given below.This identifies with the…
Q: You are working as a protein engineer. You decide to work on lacl protein ( This is the repressor…
A: An operon is a cluster of genes under a single promoter. The gene products of genes in an operon are…
Q: (a). The product of the reaction has two chiral centers as shown: The Ca atom of the amino acid…
A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…
Q: 3. What is the IUPAC name of the following compound? NH2 NH2
A:
Q: Please write it out
A: Detailed Explanation - 1. Hydrolysis of Sucrose (Not in Muscle):Sucrose, a disaccharide, isn't…
Q: None
A:
Q: __________ is never involved in the initiation of eukaryotic transcription. Question 4 options:…
A: The answer is sigma factor.Explanation:All of the factors have something to do with initiation of…
Q: 12. Consider a protein that can exist in two forms: folded (F) and unfolded (UF). Calculate the free…
A: (i.) ΔGunfolding = 2100.30 J/mol or approximately 2.10 kJ/mol (ii.) ΔGunfolding = -5446.52 J/mol…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Protein Phosphatase 2A (PP2A) Binding: Complexes of PP2A PR110 bind to MTF-1, the metal regulating…
Q: Consider the following Peptide: Alanine-Lysine-Glutamine-Serine-Glycine Select all that applies…
A: Peptides are short chains of amino acids linked by peptide bonds ( the bond between CO and NH in…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: Which of the following statements regarding polynucleotides is true? a) A double stranded DNA forms…
A: The correct answer is: a) A double-stranded DNA forms a right-handed helix, where both strands run…
Q: Histone modifications are inherited across ________ but not ________. Question 6 options:…
A: Histone modifications are inherited across mitosis but not meiosis. Histone modifications are…
Q: Arrange the steps of performing the test to detect the presence of the glycoproteins indicating…
A: The objective of the question is to arrange the steps of performing the test to detect the presence…
Q: Question 5
A: The question is asking whether a mouse would die if it was injected with a mixture of heat-treated S…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: Transcription factors are a specific type of nuclear proteins. How do transcription factors get…
A: Transcription factors are proteins that bind to the specific DNA sequences in or around the…
Q: (Biochemistry topics: Glycolysis, Citric Acid Cycle, and Electron Transport.) There is a reciprocal…
A: In the reciprocal regulation of glycolytic and gluconeogenic reactions, the interconversion of…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: 1. From the given DNA strands:a. Identify the template and non-template strand.b. Give the mRNA…
A: The answers are:(a) Template Strand:3' - G T A T A T C A G T T A G A G C T A A T C - 5' Non-template…
Q: Your colleague handed you a novel strain of coli that is purifying a protein with a 6xHisTag; they…
A: Detailed ExplainationCompetitive Metal Chelation:Dicarboxylic acids, such as citric acid, have…
Q: When 10 micrograms of an enzyme with a molecular mass of 80,000 Daultons (grams/mol) is added to a…
A: Before going into the calculations for finding the turnover number (kcat), we need to convert…
Q: For every molecule of glucose produced, gluconeogenesis consumes: O2 ATP and 2 NADH ☐ 4 ATP and 1…
A: For every molecule of glucose produced during gluconeogenesis, the process consumes 6 molecules of…
Q: Model 1 - Linear electron flow during the light reactions Identify each of the numbered elements…
A: Answers are given below:1. O22. H2O3. Primary Acceptor4. Pq (Plastoquinone)5. Cytochrome complex6.…
Q: The most important contribution to the stability of a protein's conformation appears to be the: ○ A)…
A: The most important contribution to the stability of a protein's conformation appears to be the:…
Q: 1. Draw the Fisher projection of D-glucose, and from Fisher to Haworth projection of ẞ-D-glucose.…
A: The configurations of the D-glucose are: R , S , R , RIn β−D−glucose C1 -OH is present on the up…
Q: PLease help me fill in all the information
A: 1. Pyruvate to Alanine:Pyruvate is a three-carbon compound produced during glycolysis, which is the…
Q: Corona virus tes with a 5% false positive rate and a Corona virus infection rate of 5% in Canada, if…
A: The objective of the question is to calculate the probability that a person who tests positive for…
Q: In no more than two sentences each describe electroporation
A: There are several methods or techniques that allow us to introduce foreign DNA into the host cell,…
Q: Refer to figure 1D of the Science Article. Which produces the greatest inhibition of PDE…
A: In the experiment described, the researchers tested the inhibitory effects of different…
Q: List three important characteristics of plasmids and their function
A: Here is the Three important characteristics of plasmid and their functions.Autonomous…
Q: Describe how the shape and size of nucleotides are important in the structure of double-stranded…
A: Nucleotides that make up DNA are composed of 3 components; a deoxy ribose sugar, a phosphate and a…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: A drawing of a cell in anaphase is provided. The cell contains 8 unreplicated chromosomes with…
A: Self explanatoryHope the answer was helpful. If any doubts feel free to ask for further…
Q: 2. Match the following molecules with the-corresponding test reagents that are used to identify…
A: Biochemical tests are very important in the field of biology and biochemistry. These tests are used…
Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…
A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…
Q: draw the mechanism for the glyoxalate cycle enzyme malate synthase typed solution
A: The glyoxyate cycle is an alternative pathway that allows the organism to convert acetyl CoA to…
Q: What is this TLC's Rf Value
A:
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: Question 1: Part a: Graph Y = [I] / (Ki + [I]) as a function of [I] and Ki = 2 µM; and describe the…
A: Part a:The equation Y = [I] / (Ki + [I]) represents a fractional saturation curve, often used in…
Q: The cofactor shown below: is an oxidizing agent is a reducing agent is a carrier of acyl groups is…
A: The given structure is of the FAD molecule. FAD = Flavin adenine dinucleotide.
Q: An a helix would be destabilized MOST by ○ a glycine residue adopting alpha-helical backbone…
A: The stability of an alpha-helix is influenced by various factors including the propensity of amino…
Q: In a tabular form list two differences between heat shock and electroporation as methods of…
A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…
Q: 2. Compare and contrast the biological roles of the following amino acids the following pairs of…
A: The objective of this question is to compare and contrast the biological roles of three pairs of…
Q: 2. Draw the ringed form of D-glucose with the following modifications: (a) Convert to sugar acid at…
A: Below answer given Explanation:Step 1:(A) Step 2:(B)(C)&(D) Step 3: Step 4:
Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…
A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:
Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…
A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…
Q: Vmax Km x10 TOOLS
A: Vmax and Km are the two important parameters in enzyme kinetics.Vmax is the maximum rate of an…
PART IV. HOW FAST DOES IT GO?
Another member of your research group studied the kinetics of the
GAPDH from the organism. They also determined if the GAPDH from
the organism is also inhibited by the known inhibitor of GAPDH from
humans.
A. From the following data, determine the KM (Michaelis-Menten Constant) and the Vmax
(maximum velocity) of the enzyme without and with the inhibitor.
B. If GAPDH is inhibited, what specific type of inhibition is observed?
![Without Inhibitor
[substrate], mM
Rate (Vo), mM/min
0.997774599
With Inhibitor
Rate (Vo), mM/min
0.847401
1
1.5
1.076855826
0.973852
2
1.122873947
1.037991
2.5
1.160626292
1.068431
3
1.184072485
1.105866](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fce323461-c153-4290-9260-fdb6a91da9c6%2Fccf3c35e-7b28-4cd5-8235-6c61a2008157%2Fgzlikr8_processed.png&w=3840&q=75)
AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- What is the minimum inhibitory concentration indicated in the following image?Now answer the following questions: 1. Is this patient experiencing a disorder affecting anaerobic or aerobic metabolism? a) disorder affecting anaerobic metabolism. b) disorder affecting aerobic metabolism. c) None of them d) Both 2. You decide to perform assays to check the activity of one or more metabolic enzymes in the red blood cells. Which enzyme(s) would you check? a) Amylase b) Enzymes of pentose phosphate pathways c) Transaminase enzymes d) hexokinase, phosphofructokinase, and pyruvate kinaseArchae are the source of many enzymes used for biocatalysis in diverse industries such as food and feed, pharmaceuticals, detergent, and beverage industries. These enzymes have unique structural and functional properties that enable use under extreme conditions. Use: https://biolres.biomedcentral.com/articles/10.1186/s40659-018-0186-3 for supplemental info What are three classes of extremophiles and their unique growth characteristics? Based on these characteristics, where are they typically found? The functional properties are linked to protein structural characteristics that imparts unique functional properties. For alkaliphiles and thermophiles, what structural elements (or characteristics) within the enzyme structure create these unique properties? See Table 2. Briefly discuss how the unique properties of these enzymes may be beneficial to the design of bioseparation processes. To recover intracellular enzymes, the Archae need to be lysed. Based on their structures,…
- Content × Content / Ana ☑ OntarioLearn × Content × Furosemide is ☑ ChatGPT × G Intradermal in × + ☑ ← >> https://ontariolearn.blackboard.com/ultra/courses/_30758_1/cl/outline?legacyUrl=~2Fwebapps~2Fblackboard~2Fcontent~2Flaunch...✰ S Relaunch to update : M Gmail ►▸ YouTube Maps Sign in | Permanent... Search Results login... GMy Grammarly - Gr... York Region Childre... Applications Home | bartleby (50,482 unread) - a... Remaining Time: 13 minutes, 18 seconds. * Question Completion Status: 1 points ✓ Saved QUESTION 6 Furosemide is a loop diuretic used in the treatment of edema and hypertension. It is available with a strength of 20 mg/tab. A prescriber has ordered a daily dose of 40 mg. Which of the following configurations will yield the correct answer to the dosage calculation? 40mg 1 20 mg ✗ 1 tab ○ 40mg 1 tab 1 20 mg E 1 1 tab ✗ 40mg 20 mg อ 1 40mg 20 mg ✗ 1 tab Priva Tern Acce 1 Click Save and Submit to save and submit. Click Save All Answers to save all answers. Q Search myhp W…-Inhibitor +Inhibitor [S] (mM) Vη&νβσπ: (μmol/sec). ν0&νβσπ;&νβσπ:(μmol/sec) 0.0001 33 17 0.0005 71 50 0.001 83 67 0.005 96 91 0.01 98 95 What is the TYPE of iinhibitor?Drag the labels onto the diagram to identify the anatomical terminology describing body orientation and direction (human a Posterior (caudal) Distal Superior (dorsal) Proximal Inferior (caudal) Anterior (ventral) Posterior (dorsal) Pearson arch
- The nonprotein heme group sits in the active site of the hemoglobin enzyme. The heme group facilitates the reaction of the enzyme and is required to be present for the reaction to occur. Select the best answer. Question options: Heme is an example of allosteric inhibition. Heme is an example of a product. Heme is an example of a noncompetitive inhibitor. Heme is an example of a cofactor Heme is an example of a competitive inhibitor.The hydrolysis of a substrate, S, by an enzyme has been studied in the lab. The following initial rates, vo, were recorded at different concentrations. [S] (M) Vo (M/min) 2.10-10-4 1.20.10-6 4.20-10-4 3.10.10-6 9.30-10-4 6.30-10-6 1.42-10-3 9.10-10-6 A. Determine the rate constants for degradation of the substrate B. What is the rate of reaction at [S] = 1.1.104 M? C. Explain, why enzymes can make reactions go faster? Does enzymes also catalyse the reverse reaction from product to substrate?Not graded work !
- Ulstein-freshair/Videos/D671260A4C0A005E4832B3E307A98B64/CS_Chapter_33.dom NBA... a Amazon.com: Onlin... ▸ Beyond The Lights... ▸ (6) The Reason Why... Case Study, Chapter 33, Introduction Open with Process Isaiah Blames Zora... 1. Label each scenario below with the letterthat corresponds to the step of the nursing process involved. (A) Assessment (P) Planning (1) Implementation (E) Evaluation After labeling, explain the rationale for your choices. (Learning Objectives 4, 5, 6) Scenarios: Mr. Johnson is admitted to room 337 in an acute care facility. The nurse interviews the client to determine the history of this illness, health history, and family history. The nurse then performs the head-to-toe physical assessment. Mr. Johnson has complained of acute leg pain. The nurse collects further data specifically regarding Mr. Johnson's leg pain. The nurse checks Mr. Johnson's admission orders and notes medication is ordered as needed for leg pain. The nurse returns to Mr. Johnson's room…Serum blood of a patient with dislipoproteinemia type 1 has milky appearance even in fasting. If serum stays at low temperature (40) for several hours fatty layer appears on its surface. What are the possible causes of these symptoms? To explain this, answer the questions and do the following tasks: a) what compounds of serum must be tested for that patient in biochemical lab? b) write the reaction which does not occur properly in patient’s blood; c) write down the schemes, explaining how the products of the previous reaction are used in adipose tissue and heart in healthy person 2 hours after a meal.PTP1B Substrate kcat Km kcat/Km UM 10-7 x (s-1 M) DADEPYLIPQQG DADAPYLIPQQG DAAEPYLIPQQG AAAAPYLIPQQG 44.6 + 1.8 39.8 + 0.32 3.9 + 0.9 13.7 + 0.46 1.1 + 0.25 0.29 + 0.01 35.3 + 0.22 6.6 ± 0.22 0.53 + 0.02 34.7 + 0.25 52.7 ± 0.7 0.066 + 0.001 (d) (. ) The units for kcat/KM in the above are given according to standard scientific notation. On this basis what is the value of this kinetic parameter for the DADEPYLIPQQG substrate?