Which of the following technologies would be useful to assess natural patterns of mRNA abundance in the brain of a reptile species that has never been the focus of genetic research before? Group of answer choices DNA microarray RNA-sequencing with Illumina DNA-sequencing with Illumina RNA microarray

Which of the following technologies would be useful to assess natural patterns of mRNA abundance in the brain of a reptile species that has never been the focus of genetic research before? Group of answer choices DNA microarray RNA-sequencing with Illumina DNA-sequencing with Illumina RNA microarray

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Related questions

Q: Briefly describe the procedure of AluQuant human DNA quantitation system. Explain why it is…

A: The AluQuant system used for human deoxyribonucleic acid quantitation uses certain probes that help…

Q: DNA extraction from banana is being analyzed

A: The stringy substance that you see is DNA! It has been removed from the millions and millions of…

Q: The right-hand column contains descriptions of 5 types of molecular markers. Label each description…

A: These markers are pivotal tools within the field of genetics and genomics, helping researchers…

Q: Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices

A: PCR is a technique of amplification of a given molecule of DNA to increase its copy number.

Q: Nucleic acid hybridization techniques have been essential tools of molecular diagnostics for plant,…

A: A northern blot is a laboratory method used to detect specific RNA molecules among a mixture of RNA.…

Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…

A: Answer: REPLICATION of DNA : It is the process in molecular biology where DNA strands are used to…

Q: You are performing an experiment using CRISPR-cas9 to genetically modify the LacZ gene of a culture…

A: While designing an experiment to modify the gene target sequence region is to be known where you…

Q: Choose the single most appropriate description of how most Next Generation sequencing methods work.…

A: Sequencing is the process of determining the order of nucleotides (adenine, guanine, cytosine and…

Q: How PCR may be used for the detection of disease–causing pathogens in a population during COVID…

A: In PCR, the infected gene is amplified and allows them to bind with the complimentry strand. After…

Q: After running a qPCR experiment, we will have graphs showing the amount of fluorescence detected by…

A: The Polymerase Chain Reaction is a qualitative procedure which is used to produce large copies of…

Q: The following statements are true about common gene cloning procedures except: -DNA plasmids can…

A: Biotechnology is a branch of biology, including the use of living organisms to produce products.…

Q: engineering? Provide a concrete example on your explanation. 2. Out of 4 presented methodologies…

A: Gene editing is a part of genetic engineering in which few of the required genes are added and and…

Q: Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind…

A: PCR is known as a polymerase chain reaction. This method is used to amplify the gene of interest.…

Q: What are some of the technical challenges of cloning a mammoth? Check all that are true Ancient…

A: Cloning a mammoth involves using advanced genetic engineering techniques to recreate a living…

Q: The results of the diagram (Agarose electrophoresis photodocumentation and quantification table)…

A: Agarose gel electrophoresis is the separation technique based upon the size of the macromolecule. in…

Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…

A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…

Q: In cloning a specific fragment from a mixture of different fragments of DNA, three classes of…

A: A plasmid is a small, circular, double-stranded DNA molecule that is distinct from a cell's…

Q: nucleotides, DNA template, Taq polymerase, and primers

A: The complete list of ingredients essential for PCR is nucleotides, DNA template, Taq polymerase, and…

Q: A scientist wants to make a random mutation in a specific gene to investigate that gene's function.…

A: A random mutation is a change in the sequence of nucleotides that makes up an organism's genetic…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Which of the following technologies would be useful to assess natural patterns of mRNA abundance in the brain of a reptile species that has never been the focus of genetic research before?

Group of answer choices

DNA microarray

RNA-sequencing with Illumina

DNA-sequencing with Illumina

RNA microarray

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Order the steps of generating a yeast knockout.
Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
Describe two of the applications for genome mapping.
Select all that would be true if I had a nonsense mutation in an exon of a gene: The nonsense mutant allele would be the same size as wildtype by PCR-electrophoresis The nonsense mutant protein would be the same size by Western as the wildtype protein The nonsense mutant allele would be a different size compared to wildtype by PCR- electrophoresis The nonsense mutant protein would be a different size by Western compared to the wildtype protein
Each of the following describes a distinctive step in a genomic technology or experimental design. Match the name of the technology or experimental design to the description. Answers may be used more than once or not at all. Add fluorescent tags onto the single-stranded sample of nucleic acids before the sample is applied to a glass slide. [ Choose ]When aligned to a reference genome, read depth indicates duplications and deletions. [ Choose ]A spot appears as a mix of two fluorescent colors if the individual is heterozygous. [ Choose ]An experimental design that relies on identifying unrelated individuals that have one of two phenotypes, then looking for a correlation between individual phenotype and genotype. [ Choose ] choices: GWAS, RNA microarray, RNA sequencing, DNA microarray, quantitative genetics, family study, genomic resequencing
Select the definition of a microsatellite. short pieces of DNA surrounding the periphery of the nucleus short pieces of DNA that flank most genes segments of DNA cut by restriction enzymes small DNA sequences that are repeated consecutively a few times to many times O pieces of DNA that can move through the genome by transposition How are microsatellites used in genetic studies? to identify individuals within a population used as markers in the sequencing of the human genome to identify genetic variants in genome-wide associations studies to test if a population is in Hardy–Weinberg equilibrium to transfer genes between organisms O O
An organism no longer needs to express a particular gene. What is one strategy it might use of the methods discussed in class? Select all that apply. 0.000 de-methylate C bases in the genome acetylate C bases in the genome methylate C bases in the genome acetylate histones de-acetylate histones de-acetylate C bases in the genome
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
A scientist wants to make a random mutation in a specific gene to investigate that gene's function. Which of the following methods is she likely to have used to make this change? mutagenesis with radiation random mutagenesis CRISPR-Cas9 genome editing followed by nonhomologous end joining (NHEJ) CRISPR-Cas9 genome editing followed by homologous recombination (HR) with a donor template oligonucleotide-directed mutagenesis
For each of the following scenarios describing gene annotation, choose the answer that best fits A researcher searches a database of sequence motifs for matches to parts of a gene's sequence. A researcher searches for a genomic region that includes particular characteristics that include the following: a CpG island near a promoter, a TATA box and 5 and 3' splice sites. A researcher identifies genes based on known expression. Choose ab initio annotation in a eukaryotic genome ab initio annotation in a prokaryotic genome homology-based annotation ab initio annotation to investigate a gene's function
Which of the following is FALSE of functional genomics? Select ALL that apply. RNA seq is a functional genomics approach CHIP seq is a functional genomics approach It seeks to elucidate the roles of genetic sequences of a given species Was invented by Carey Mullis Seeks to edit the DNA sequence of the organism Artificial selection is a functional genomics approach
During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification