Which of the following mutations would be more detrimental to an organism? 1) a mutation that changes the codon GGU to GGA 2) a mutation that changes the codon AAU to UAA 3. a mutation that changes the codon AGU to UCA 4. a mutation that changes the codon UUA to CUU The genetic code Second letter of codon Phenylalanine Phe) Leucine (Leu) Tyrosine (Tyr) Stop codon Stop codon Cysteine (Cys) Stop codon UG Loyptophan (Trp) Serine (Ser Histidine ) Proline Pro) CAG Arginine (Arg Cu Leucine Leu) CGA Glutamine (Gin) CUC boleucine le) Asparagine (Asn) AGU Serine (Ser Threonine (The) AUA AGA Arginine Arg Methionine: start codon Lysine lys) GAU Aspartic acid (Asp) Valine (Val) Alanine (Ala) Glycine (Gy GAA Glutamic acid (Glu AAU to UAA GGU to GGA AGU to UCA UUA to CUU INd letter of codon 图国E First letter of codon

Q: Which of the following is a feature of tRNA that is important for its function in translation? O The…

A: Ans : Most important feature of tRNA that is important for its function in translation is - the…

Q: A tRNA has the anti-codon sequence 5' UAC 3. What amino acid do you expect to be attached to this…

A: Translation is a process in which sequence of nucleotides in mRNA is translated into the sequence of…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Which of the following is a true statement concerning codons  A codon Will be read by RNA…

A:

Q: Which of the following mutations in a gene will most likely have the greatest impact on the…

A: Mutation is any change in structures or functional aspects of gene (genome ) which may occur due to…

Q: What happens if you replace the trp codons in the trp leader sequence with codons specifying…

A: If the tryptophan is replaced in the trp codon sequence with codons specifying isoleucine, the cell…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ a) There are two…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: What is the initiator codon in both prokaryotres and eukaryotes? What amino acid is specified by…

A: The codon AUG is known as the START codon as it the principal codon in the deciphered mRNA that goes…

Q: The degeneracy of the codon system allows for silent mutations since often a mutation at the third…

A: Silent mutation is a mutation in which a change in the sequence of nucleotide bases with no change…

Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…

A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Which of the following base pairings are allowed between an anticodon and the 3' base of a codon,…

A: According to wobble hypothesis, the third nucleotide of anticodon is a wobble and can base pair with…

Q: This one is "charged" with an aminoacid. The specific sequence in the bottom is called the…

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'As following the rules in genetic code the mRNA…

Q: A mutation occurs within a gene sequence but no change is detected in the amino acid sequence. What…

A: Mutation is any change in the nucleotide sequence that occur in the DNA which can alter the amino…

Q: The following base sequence is a complete polynucleotide made in a bacterial cell. AUG, GCC, AUG,…

A: The process of transcription entails creating mRNA from a DNA template. A complementary mRNA strand…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…

A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides.  We…

Q: A point mutation within a codon that does not change the resulting amino acid sequence is known as…

A: Mutation is a change of nucleotide sequence of DNA. When there is a change in single nucleotide of…

Q: Which of the following describes a silent mutation that is undetectable in the final protein…

A: Mutation can be outlined as the variation within the sequence of DNA. It generally occurs as a…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: A- Anticodon

A: Translation: It is the process of synthesis of protein from the mRNA inside the ribosome. The t-RNA…

Q: Which of the following statements about a transversion mutation in the sequence AGC is true?

A: Transversion alludes to a point mutation in DNA in which a solitary (two rings) purine is changed…

Q: What amino acid is coded by each codon? Note: Reference the Genetic code table for additional…

A: In molecular biology, the genetic code is the set of rules used by living cells to translate…

Q: A point mutation that changes a codon specifying an amino acid into a stop codon is called a

A: Point mutations are those which substitutes one nucleotide (within) a codon into another. Due to…

Q: Give two reasons why a point mutation in the codon for methionine (Met) would likely be more serious…

A: Point mutation is a mutation where a single nucleotide is changed i.e. insertion, deletion or…

Q: Refer to the following illustration to answer the question. mobile genetic elements exon 1A…

A: Transposable genetic element are the DNA sequences which can shift their original locations and…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: 40/ In eukaryotes, there 3 A. 59 codons code for amino acids, while 5 codons are stop B 60 codons…

A: Introduction :- Eukaryotic cells have a membrane-bound nucleus, whereas prokaryotic cells do not.…

Q: Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: result

A: Transition mutation is nothing but the replacement of one purine nucleotide with other and one…

Q: Which of the following would be most likely to have a dramatic effect on the amino acid sequence of…

A: The protein is a sequence of amino acids. The two amino acids are joined by peptide bond.

Q: (3) If a DNA sequence is 5' TCC GGT CAT 3' what are the RNA and protein sequences that can be made…

A: Chargaff rule:The rule that in DNA there is always equality in quantity between the bases A and T…

Q: The 3 sites that bind tRNAs on a ribosome are on the A, P and E sites. How many sites can tRNA(s) be…

A: Translation is the formation of protein from mRNA. It occurs in cytoplasm of cell.

Q: A mutation that changes a normal codon to a stop codon is called a

A: The mutation is a permanent alteration in the DNA sequence that makes up a gene, such that the…

Q: Now imagine that a mutation occurred in the g of the codon below and the G became a C. How would…

A: a mutation occurred in the g of the codon below and the G became a C   A  T  G Changes to A  T  C…

Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which one of the following is a codon for amino acid valine RNA triplet code GUU? AGT CAA GUC UGA…

A: DNA contain genetic information that are transcribed into the RNA and then translate into the…

Q: Complete the following tables: CODE: T-A-C A-T-G C-C-G T-G-G A-A-T C-G-C A-T-T CODON: ANTICODON:…

A: Protein synthesis consists of two main steps - transcription and translation. During the process of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.