Which of the following Is true of the leading strand? A it is synthesized discontinuously at the same rate as the other strand B) it is synthesized discontinuously based on a ds DNA template. c it is produced first, way before the synthesis in the other strand starts D) it is synthesized continuously based on a ds DNA template.

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: Which of the following is necessary for a PCR reaction to proceed? a) the sequence of the ends of…

A: PCR is a scientific method for amplifying a particular DNA segment from just a small portion of…

Q: In replication, if reading the template leading strand from left to right reads in the 3' to 5'…

A: During cell division, DNA replication is the process by which DNA duplicates itself. A replication…

Q: Double-stranded breaks are repaired by: a). direct reversal of DNA damage b). recombinational repair…

A: Ionizing radiation and radio-mimetic compounds induce DNA double-strand breaks (DSBs), but they may…

Q: In the gel electrophoresis: the mutant would just run the same as the open circle DNA if it simply…

A: In gel electrophoresis, the behavior of mutant DNA in comparison to open circle DNA and the presence…

Q: In the diagram below, the arrow indicates the direction of movement of a replication fork.…

A: DNA (deoxyribonucleic acid) is a nucleic acid. They are double  helical structure that wind around…

Q: Draw a replication origin in E. coli. Place the first 4 primers in the figure. Show how the…

A: Answer :-

Q: The polymerase chain reaction uses Taq polymerase rather than a DNA polymerase from E. coli, because…

A: Taq polymerase is use to amply the DNA in polymerase chain reaction

Q: Which of the following processes of genetic information flow can occur under lab conditions, but has…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Select the sequences that would be recognized by a restriction enzyme? (There can be more than one…

A: Restriction enzymes are a group of enzymes that can cut double-stranded DNA. They are endonucleases…

Q: A mutation occurs that changes a codon from UCC to UCA. It turns out that this codon is for an amino…

A: Based on the nature of change that occurs in a codon due to a point mutation (mutation at a single…

Q: Where does a restriction endonuclease cuts DNA?a) Ligation siteb) Recognition sequencec) Orid)…

A: Restriction endonucleases are enzymes that cut the DNA strand at a specific sequence. They are…

Q: In a sequencing reaction, the dATP was left out of the tube.What would be the result of this…

A: Polymerase chain reaction (PCR) is a technique broadly used to quickly make millions to billions of…

Q: Which of the following is/are true of DNA general recombination? The process involves invasion of a…

A: DNA recombination in general is a natural process that occurs in a wide range of organisms,…

Q: During replication, mistakes can be introduced into DNA during replication such that the wrong base…

A: During the replication, E. coli prevents re-initiation of replication immediately from oriC. One…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: How are "sticky ends" generated in DNA? A) by gel electrophoresis O B) by cutting with restriction…

A: Sticky ends or the conhesive ends are the overhangs created in a Dna strand, generally using an…

Q: What would be the a.) Product of replication b.) Product bof transcription of the following fragment…

A: Deoxyribonucleic acid or DNA is a type of nucleic acid present in the nucleus of the cell. It is a…

Q: complimentary sticky ends

A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…

Q: new dNTPs can be added at the start of replication, this is done by an enzyme called      RNA…

A: DNA is made up of deoxyribonucleotides. DNA exist in two strands and both the strands are linked by…

Q: Which is not a property of DNA polymerase? a) It requires a primer to begin synthesis b) It adds…

A: Note : As many questions have been asked, only the first multiple choice question (question number…

Q: To promote genetic diversity in bacteria, it has been found that some species have a genetic…

A: "Genetic variation" is the result of the recombination of genetic material during the inheritance…

Q: Which of the following are unique to RNA polymerase and not found in RDRP? (In other words not…

A: DNA template- Rna polymerase requires a DNA template and unique to RNA polymerase

Q: 16. Which of the following enzyme repairs the DNA backbone during molecular cloning (that is you are…

A: Answer: Introduction: Molecular cloning is a genetic methods in biotechnology, which are utilized to…

Q: Figure 2 illustrates the important elements of a cosmid. a) Briefly describe the importance of…

A: In the recombinant DNA technology the foreign DNA or target DNA is inserted into the vector then the…

Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that…

A: Introduction: Polymerase chain reaction is a method which is used to amplify a small amount of DNA…

Q: The work ‘Hybridization’ in DNA finger printing meansa) Pairing between the nucleotides of DNA…

A: DNA fingerprint is by using the DNA sequence identifies individual a person is called DNA finger…

Q: Which of the following processes of genetic information flow can occur under laboratory conditions,…

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule which is the genetic material in…

Q: Deamination of cytosine to form uracil can happen spontaneously during replication. It can be…

A: Deamination is a chemical process that removes an amino group from a molecule, such as a nucleotide…

Q: lication fork. O Top; Top ) Which template strand (top or bottom) is the lead strand? D) Which…

A: No DNA synthesizing enzyme that is no DNA polymerase can initiate the synthesis of the new DNA. It…

Q: In sequencing methods, the role of the electrophoresis is a)To stop the replication at that base…

A: Electrophoresis is a technique used in DNA sequencing methods to separate DNA fragments based on…

Q: double-stranded length of DNA is exposed to a restriction enzyme.  The enzyme finds 3 recognition…

A: Restriction enzymes Restriction enzymes are the specific enzymes that cleave the DNA in very…

Q: An example of RNA-dependent DNA polymerase isa) Reverse transcriptaseb) DNA ligasec) RNA polymerase…

A: Polymerases are the enzymes involved in the synthesis of nucleic acids. They can be DNA-dependent or…

Q: An experiment is performed with Primase, using a specific DNA template. In this experiment, you…

A: Radiolabeled nucleotides are used for the detection of specific nucleic acid sequences. For…

Q: Explain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the…

A: It is principally selected to replication-obstructing DNA sores (lesions) to combine the early…

Q: i the polymerase chain reaction, the DNA denaturation step requires a emperature in the range of ?°…

A: SOL1 In humans, fertilization is the fusion of a human egg or female gamete and sperm or male gamete…

Q: If a bacterium possesses a mutation in the gene for DNA polymerase III, resulting in an enzyme…

A: In general, DNA replication is a very accurate process. Random mistakes occasionally occur and are…

Q: With respect to DNA and RNA polymerases which statement is correct? OA) Only DNA polymerases are DNA…

A: DNA and RNA polymerases are enzymes that work on DNA. DNA polymerase is responsible for DNA…

Q: The activity of restriction enzymes may produce fragments with sticky ends.  Sticky ends are   a) a…

A: Correct option is (c). Restriction enzyme, also called as restrictions endonucleases,  is a…

Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…

A: Answer

Q: Recombinational repair is often due toa) Incorporation of many incorrect nucleotides by DNA polb)…

A: The damage to deoxyribonucleic acid is a common occurrence in all cells. Most of this damage is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.